ID: 953107667

View in Genome Browser
Species Human (GRCh38)
Location 3:39900974-39900996
Sequence CAAGCGTAACAGGTTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953107663_953107667 16 Left 953107663 3:39900935-39900957 CCTGTTTTGCTCAGCAGCGTACA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 953107667 3:39900974-39900996 CAAGCGTAACAGGTTTCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953107667 Original CRISPR CAAGCGTAACAGGTTTCCTG AGG Intronic