ID: 953108066

View in Genome Browser
Species Human (GRCh38)
Location 3:39905082-39905104
Sequence GCTCCTACCTCCAGGTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953108066 Original CRISPR GCTCCTACCTCCAGGTGCTT TGG Intronic
900277831 1:1843797-1843819 GCTCGCACCTCCCAGTGCTTTGG + Intronic
901163616 1:7199072-7199094 GCGCAAACCTCCAGGCGCTTAGG - Intronic
901632931 1:10656728-10656750 CCTCCTCCCTCCAGGTTCTCGGG - Exonic
902873813 1:19329315-19329337 GCTCCTTCCCCAAGGTGCTGAGG + Intergenic
902912815 1:19613193-19613215 GCTCCCACTTGCAGTTGCTTTGG + Intronic
903199437 1:21722276-21722298 GCTCATACCACCAAGAGCTTTGG + Intronic
905393001 1:37650265-37650287 GCACCTACCGCCAGGCCCTTTGG + Intergenic
905576397 1:39048208-39048230 GCTTCTACCTCCCGGGGCTTAGG + Intergenic
905648383 1:39640035-39640057 GCTCCTGCCTCCTGGTGTTCTGG + Intergenic
906416365 1:45623431-45623453 GCTGTTACCTCCAGGTGCAGTGG - Exonic
907923349 1:58933191-58933213 GCTCCTTCCTCCAGCTGCCTGGG + Intergenic
908389894 1:63674932-63674954 GTTGCTACCTCCTGGTGCTTTGG + Intergenic
908910987 1:69072174-69072196 GCCCATACCACCAGGTCCTTGGG - Intergenic
915749823 1:158196021-158196043 TCTGCCAGCTCCAGGTGCTTAGG + Intergenic
916028500 1:160855983-160856005 GCTCCTTCTCCCAGGTGCTCAGG - Intronic
916262680 1:162858180-162858202 GCTTCTGCCTCCATGTCCTTTGG - Intronic
917941561 1:179927501-179927523 GCTCCTACTTCCAGCCTCTTAGG + Intergenic
920455082 1:206094959-206094981 CCTCCTACCTCAGGGGGCTTTGG + Intronic
922800901 1:228364384-228364406 GCTCCTCCCTCTAGCTGCCTGGG + Intronic
922874969 1:228933427-228933449 GGTCATATCTACAGGTGCTTGGG + Intergenic
924248496 1:242108056-242108078 TTTCCTACCACCAGGTCCTTGGG + Intronic
1070588054 10:77780972-77780994 ACCCCCACCTCCAGGTGATTGGG - Intergenic
1075921666 10:126218512-126218534 CTTCCTCCCTGCAGGTGCTTGGG + Intronic
1077528962 11:3086379-3086401 GCCCCATCCTCCAGGTGGTTCGG + Intergenic
1078733944 11:14002669-14002691 GCTCCTGCCACCAGGCTCTTGGG - Intronic
1079349414 11:19679980-19680002 GCCCCTCACTCCAGGTGCCTTGG - Intronic
1080103673 11:28489146-28489168 GCTCCTAGCTCCTCTTGCTTTGG + Intergenic
1081021063 11:37948111-37948133 GCACCTACTTGCAGCTGCTTAGG + Intergenic
1083777965 11:64903417-64903439 GATCCTTCCCCCAGGTGCTGGGG - Intronic
1084905924 11:72347330-72347352 GCTCATAACTCCAGCTACTTGGG + Intronic
1087591850 11:100199351-100199373 GATCCTACCTCTTGGTTCTTTGG + Intronic
1087632701 11:100669482-100669504 GCCCCTATTTCCAGGTACTTGGG - Intergenic
1089619355 11:119713585-119713607 CCTCTTATCTCCAGGTGCTCTGG + Intronic
1091652573 12:2320805-2320827 GCTCCTACCCCTAGCTGCCTTGG - Intronic
1091950961 12:4592734-4592756 GCTCTAACCCCCAGGTGTTTGGG + Intronic
1092330625 12:7583746-7583768 GCTCCCTCCTCCAGATGCTGGGG - Intergenic
1100440744 12:94615014-94615036 TCTCCCACCCCCAGGTGTTTTGG + Intronic
1101261664 12:103038211-103038233 GCTCTTATCTCCAGGTGAATTGG + Intergenic
1103738729 12:123077550-123077572 ACTCCTGCCTCCTGGTGCTTGGG - Intronic
1105018204 12:132798936-132798958 GCCCAGACCTCCAGGTGCTCAGG + Intronic
1106022996 13:25932269-25932291 GCACCTACCTCCAGTCTCTTGGG + Intronic
1110730513 13:78874930-78874952 GCTTCTACTTGCATGTGCTTTGG - Intergenic
1116492910 14:45527031-45527053 GCTCCTTCCTCCAGATGCACTGG - Intergenic
1118306720 14:64661234-64661256 GCCCCTACAGCCAGGTGCTGTGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119739075 14:77002168-77002190 GCTCCTACCTCCCGGCACTTTGG - Intergenic
1121534746 14:94683853-94683875 TCTCCTCCCTCCTGGTGTTTTGG + Intergenic
1122437582 14:101710470-101710492 GCTCCTGCCTCTTGGTGTTTGGG - Intergenic
1122654173 14:103246203-103246225 GCTCCTTCCTCCAGGCACATGGG + Intergenic
1122782696 14:104150275-104150297 GCCCCTCCCTCCTGCTGCTTCGG - Intronic
1125481186 15:40082118-40082140 GCTCTTGCTTCCAGTTGCTTCGG - Intergenic
1128513260 15:68326605-68326627 GCTCCTTCCTATAGGAGCTTGGG + Intronic
1129974478 15:79810800-79810822 GCTCCTGCCTCCTAGTCCTTGGG + Intergenic
1130642359 15:85690090-85690112 GCTCTTACCTCCCCATGCTTTGG - Intronic
1131069253 15:89454918-89454940 GCTCTGACCTCCAGGAGCTCGGG + Intergenic
1131290924 15:91106166-91106188 GCTACTCCATCCAGCTGCTTAGG - Intronic
1131418986 15:92287751-92287773 GCTCCATCTTCCAGGTACTTAGG + Intergenic
1133756736 16:8767537-8767559 CCGCCTACCTCCAGCTGCTGGGG - Intronic
1134811711 16:17172897-17172919 GCTCATACCTCCTGCTTCTTGGG + Intronic
1139431139 16:66911659-66911681 GGTCCTCCCTCCAGGTGCTGAGG + Intronic
1139651902 16:68366386-68366408 GTTCGTACCCCCAGGTGCTGGGG - Intronic
1139787551 16:69406192-69406214 GAGCCTACCTCCAGCAGCTTGGG + Intronic
1139797871 16:69497746-69497768 GCTCCTAACTCCGGGAGGTTTGG - Intergenic
1142320530 16:89379650-89379672 CCTCCCACCTCCAGGTGACTGGG + Intronic
1143215703 17:5223295-5223317 GCTCCTCCCTCCACCTGCCTAGG + Intronic
1144046130 17:11456281-11456303 GCTCCCTCCACCAGGTGCCTCGG - Intronic
1145904919 17:28511021-28511043 GCTCCTTCCTCCAGGTGCTGGGG - Intronic
1148635826 17:49148698-49148720 TCTGCCAGCTCCAGGTGCTTAGG + Intronic
1148931160 17:51128406-51128428 CCTCCTACCTCAGGTTGCTTGGG + Intergenic
1157745742 18:50133759-50133781 CCTCCCACCTCCAGGAGCCTGGG + Intronic
1159361529 18:67410851-67410873 GTTCCTCCCTCCAGAAGCTTTGG - Intergenic
1160536835 18:79599014-79599036 GCCCCTGCCTCCAGGTGCGCTGG - Intergenic
1161686196 19:5703854-5703876 GCTCCTTCCCCCAGGAGCTGAGG - Intronic
1162378887 19:10320766-10320788 GCTGCCACCTCCAGGGGCTGGGG + Exonic
1162966810 19:14160051-14160073 GCGCCTGCCCCCAGGGGCTTGGG - Intronic
1163325795 19:16602306-16602328 GGACCTACCTCCAAGTGCTCAGG - Intronic
1163635637 19:18436023-18436045 GCTCCGGCCTCAAGGTGCGTGGG - Exonic
1164644135 19:29845428-29845450 GCTGCTGCCTCCAGGGGCTTAGG + Intergenic
1164782327 19:30902958-30902980 GCACCTACCACCAGGTGCTGGGG + Intergenic
925048810 2:795604-795626 GCTCCTGACTCCACGTGCCTGGG - Intergenic
927264008 2:21124124-21124146 CCTCCGACCTACAGGGGCTTTGG + Intronic
930538235 2:52670952-52670974 CCTCCTACCTCCAAGTTCTGAGG + Intergenic
935234989 2:101130761-101130783 ACTGCTACATCCAGGTGCCTGGG + Intronic
936789321 2:116132521-116132543 TCTTCTACCTGCAGGTGTTTTGG + Intergenic
937815435 2:126245262-126245284 GCTCCTGCCTCGTGATGCTTTGG - Intergenic
943320305 2:186436214-186436236 TCTCCTACCTTCAGGGGCATTGG - Intergenic
943369806 2:187002507-187002529 ACCCCCACCTCCAGGTGATTGGG - Intergenic
943476815 2:188367387-188367409 AAGACTACCTCCAGGTGCTTTGG + Intronic
944653587 2:201856584-201856606 GCTCCTATCTCCAGTTGCCATGG + Intronic
946167564 2:217874301-217874323 GCACCCACCTACAGGTGTTTGGG + Intronic
946392812 2:219426547-219426569 GCTCCCACCTCCAGCACCTTCGG - Exonic
948944985 2:241214950-241214972 GCTGCTACTGCCAGGTGCTCTGG - Intronic
1169363113 20:4968340-4968362 CCTCTGACCTCCAGGTGCTGGGG - Intronic
1171261047 20:23734952-23734974 ACTCCTCCCTTCAGGTGCATAGG - Intergenic
1171270166 20:23810794-23810816 ACTCCTCCCTTCAGGTGCATAGG - Intergenic
1173732424 20:45338070-45338092 GCTCCTACCTCCATCTCCTGTGG + Intronic
1174335523 20:49857168-49857190 GCTCTTTTCTCCACGTGCTTTGG - Intronic
1175756506 20:61533546-61533568 GCTCCTACCTCCAGCAGCCCCGG - Intronic
1178338126 21:31762126-31762148 GCTCATAACTGTAGGTGCTTGGG + Intergenic
1179275177 21:39885555-39885577 TGTCCTACCTCCATGTGGTTTGG + Intronic
1180944120 22:19680356-19680378 GCTGCTGCCTCCTGGTCCTTTGG - Intergenic
1181652774 22:24270023-24270045 TCTGCCAACTCCAGGTGCTTAGG + Intergenic
1183288733 22:36984581-36984603 GCTCCTGGCCCCAGGTGATTTGG - Intergenic
951050963 3:18092878-18092900 ACTCATACTTCCAGTTGCTTAGG + Intronic
953108066 3:39905082-39905104 GCTCCTACCTCCAGGTGCTTTGG + Intronic
953433400 3:42858059-42858081 GCCCCTTCCCCCAGGTGCTCTGG - Intronic
953923588 3:46968753-46968775 CCTCTCACCCCCAGGTGCTTGGG - Intronic
954811361 3:53250305-53250327 GCTCTGACATCCAGGTGCTTTGG - Intronic
955824062 3:62926458-62926480 TCTGCCAGCTCCAGGTGCTTAGG - Intergenic
957920414 3:86740914-86740936 GCTCCTTTCTCACGGTGCTTAGG + Intergenic
960561108 3:119084800-119084822 GCTCCCTCCTCCAGGTCCTCAGG - Intronic
966923094 3:184627267-184627289 GGCTCTACCTCCAGGGGCTTAGG - Intronic
968466561 4:754479-754501 CCTTCTACCTCCAGGGGCTCTGG - Intronic
969183701 4:5460469-5460491 AATCCCACCTCCAGGTGCTCAGG + Intronic
969322489 4:6421108-6421130 GCTCATACCTGCATGTGTTTTGG - Intronic
973534232 4:51865299-51865321 GCTCCTCCTTCCAGGTGTTGTGG - Intronic
979561458 4:122106537-122106559 CCTGCTCCCTCCAGGTGCTCTGG - Intergenic
980235466 4:130099373-130099395 ACTCATACAACCAGGTGCTTAGG + Intergenic
980766003 4:137305067-137305089 TCTCCTACCTTCAGCTGCCTTGG + Intergenic
982397215 4:154925592-154925614 GCACCTCCCTGCAGGGGCTTTGG - Intergenic
985512598 5:321036-321058 GGTCCTGCCTGCAGGTCCTTAGG - Intronic
986747055 5:10754143-10754165 GTTCCCACCTTCAGGTGCATGGG - Intronic
988324676 5:29747948-29747970 CCTTCTTCCTCCAAGTGCTTTGG + Intergenic
995230945 5:109762634-109762656 CCTCCTACCTCAAGGTGCCTTGG + Intronic
997292967 5:132750588-132750610 GCTCATACCCAAAGGTGCTTTGG - Intronic
998172709 5:139881906-139881928 GCACCTACCCCAGGGTGCTTAGG + Intronic
999546343 5:152632703-152632725 GCTCCTCCTTCCAGGTGGTGGGG + Intergenic
1002060152 5:176621065-176621087 GCTCCCACCTCCTGGGGCCTGGG + Intronic
1002613644 5:180437064-180437086 GCTGCGACCTCGAGGGGCTTTGG + Intergenic
1004732060 6:18367681-18367703 ACCCCAACCTCCAGGTGATTGGG - Intergenic
1004870884 6:19902745-19902767 GCAACTACCCTCAGGTGCTTTGG + Intergenic
1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG + Intergenic
1005505231 6:26463635-26463657 GCTGCAGCCTCCAGGTCCTTAGG - Intronic
1006340453 6:33443689-33443711 GCTCCCACCTCCAGGCCCTGAGG - Exonic
1007667597 6:43524610-43524632 GCTCTTATCTCCAGGTACCTGGG + Exonic
1008082569 6:47209705-47209727 CCCCCTACCTCCAGGGCCTTGGG + Intergenic
1008497494 6:52147572-52147594 GGTCCTACTTCCAGATGTTTCGG + Intergenic
1014169835 6:118266707-118266729 TCTCCTGCCTCCAGGTGCTGGGG - Intronic
1016814026 6:148287133-148287155 TCTCCTTCCTCCAGATGCTTGGG + Intronic
1017064365 6:150515914-150515936 GCTTCTGTCTCCTGGTGCTTGGG + Intergenic
1018195359 6:161351750-161351772 GCTCTTATCTCAAAGTGCTTTGG - Intronic
1018548509 6:164964509-164964531 GTTCCTACAGCCAGATGCTTTGG + Intergenic
1018632542 6:165833625-165833647 GCTGCTCCCTCCAGGAACTTGGG - Intronic
1019733714 7:2640490-2640512 GGTCCTGCCACCAGGTGCTCCGG + Intronic
1021200735 7:17726438-17726460 GCACCTACCTCCAGGGCCCTTGG + Intergenic
1025212969 7:57031549-57031571 GTTCCTACCCCCAGGAGCTCAGG - Intergenic
1025658984 7:63545275-63545297 GTTCCTACCCCCAGGAGCTCAGG + Intergenic
1026483349 7:70797380-70797402 GCCCCTGCCTCCAGGAGCTGAGG - Intergenic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1028998320 7:97126420-97126442 GCCCCTTCCCCCAGGTGCTGTGG + Intronic
1029066539 7:97855100-97855122 GCTCATACCCCCAGCTGCTGAGG - Intronic
1030554824 7:111010709-111010731 GGTCCTCCATCCAGGTACTTTGG + Intronic
1032019170 7:128396939-128396961 ACCCCCACCTCCAGGTGATTGGG - Exonic
1033097096 7:138441581-138441603 ACCCCCACCTCCAGGTGATTGGG + Intergenic
1033355528 7:140595955-140595977 TTTCCTACCACCAGGTGCTCAGG + Intronic
1033606646 7:142932599-142932621 GCTTCTTCCTCCAAGTGTTTTGG - Intronic
1035106034 7:156442054-156442076 GCTCCCACCTCCAAGAGCTGAGG + Intergenic
1036747029 8:11417149-11417171 GCACCTACCTCCAGCTCCGTTGG + Intronic
1042337431 8:67643239-67643261 TCTCCTACCTCTTGGTGCTGTGG - Intronic
1042402176 8:68362400-68362422 GCTCCTCCCTCCATGGCCTTTGG - Intronic
1043982954 8:86661740-86661762 TCTCAAACATCCAGGTGCTTAGG + Intronic
1046246645 8:111572467-111572489 CCTCCTACGACCAGGTGCTATGG - Intergenic
1046734771 8:117765496-117765518 GCTCCTACCTACAGATGTCTTGG + Intergenic
1047275358 8:123401452-123401474 ACTCCCACCTCCAGGTGATTGGG + Intronic
1049814465 8:144591675-144591697 GCCCCGCCCTCCAGGTGCTCAGG - Intronic
1049906486 9:221997-222019 GAACCTGCCTCCCGGTGCTTTGG + Intronic
1052025203 9:23566303-23566325 TCTCCTTCCTCCAGGTTCCTGGG + Intergenic
1052964503 9:34329577-34329599 CCTCCTACCTCCTTCTGCTTCGG + Exonic
1056580451 9:87885523-87885545 CCACCTACCTCCATGTGCTTGGG - Exonic
1057211744 9:93204390-93204412 AGTTCTACCTGCAGGTGCTTGGG - Intronic
1057435962 9:95040697-95040719 GGTCCCACCTCCAGGAGCTTGGG - Intronic
1060197705 9:121634197-121634219 GCTCCTACCCCGGGGTGCATAGG - Intronic
1061882663 9:133575835-133575857 GCACCCACCTCCAAGTGCGTGGG + Intergenic
1061900984 9:133671858-133671880 GCTGCTCCCTCCAGCTGCTCTGG + Intronic
1186417710 X:9398191-9398213 CCTCCTGCCTCCAGGAGCATGGG - Intergenic
1186539613 X:10387213-10387235 CCTCCTTCTTCCAGTTGCTTGGG - Intergenic
1189127170 X:38460985-38461007 GTTCCTATCTCCAGTTTCTTTGG - Intronic
1189361969 X:40359825-40359847 ACCCCCACCTCCAGGTGATTGGG - Intergenic
1189702566 X:43727275-43727297 GCCCCTTCCCCCAGGTGCTCTGG + Intronic
1191874693 X:65784363-65784385 GCTGTTACCTTGAGGTGCTTTGG - Intergenic
1191967533 X:66776580-66776602 GGTCCTACATCCAGGGTCTTGGG - Intergenic
1192915967 X:75651824-75651846 GCTCTTTCCTCCAGAAGCTTCGG + Intergenic
1195230831 X:102845297-102845319 GGTCCTGCCTTCAGGTGTTTGGG + Intergenic
1195293285 X:103449883-103449905 GGTCCTGCCTTCAGGTGTTTAGG + Intergenic
1197706952 X:129641019-129641041 GCTCCTCCCTACAGGTCCCTGGG + Intergenic
1198277774 X:135112733-135112755 GCTCCCTCCTCCAGATCCTTGGG + Intergenic
1198387668 X:136145002-136145024 GCTCCTAGCACCAGGGGCCTGGG - Intergenic
1200081593 X:153579439-153579461 GCTCATACCAGCAGGTACTTCGG + Intronic