ID: 953108141

View in Genome Browser
Species Human (GRCh38)
Location 3:39906034-39906056
Sequence CATATGTGCAGAGCATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953108137_953108141 19 Left 953108137 3:39905992-39906014 CCTGGGGAGCGTGCAGAGGTGGA 0: 1
1: 0
2: 1
3: 22
4: 344
Right 953108141 3:39906034-39906056 CATATGTGCAGAGCATGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953108141 Original CRISPR CATATGTGCAGAGCATGCTT TGG Intronic
903933270 1:26876846-26876868 CATGGGTGCAGAGAATGCTGAGG + Exonic
905770503 1:40635033-40635055 CCCAGGTGCAGAGCATGCCTGGG - Intronic
905808886 1:40897508-40897530 CATATGTGTAGCTCATGCTTTGG + Intergenic
907127988 1:52068887-52068909 CATTTGTGCAGAGAAGGGTTAGG + Intronic
908213268 1:61923393-61923415 AAAATGTGCCCAGCATGCTTTGG + Intronic
910603370 1:89055503-89055525 CATATGGGCTGAGCCTGCTGGGG + Intronic
910637346 1:89423611-89423633 CATATGGGCTGAGCCTGCTGGGG - Intergenic
911700945 1:100951135-100951157 CAGATATGCAAAGCAAGCTTTGG + Intronic
915469239 1:156115724-156115746 CATGTGTTCAGAGCCAGCTTGGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916830148 1:168482482-168482504 CATATGTGCACAGAAGGCTGTGG + Intergenic
920058390 1:203210399-203210421 CATATGTGTAGAATATGCCTAGG - Intergenic
921009725 1:211129336-211129358 CATATATGCAGAGCTGGCATCGG + Intronic
922901301 1:229138854-229138876 CATAGGAGCAGGGCATGCTTTGG - Intergenic
1064120974 10:12618934-12618956 CATCTTTGCTGTGCATGCTTAGG - Intronic
1064669511 10:17696538-17696560 CATAACTGCAGAGCATGCATTGG + Intronic
1065346843 10:24756616-24756638 AAGATGTGCTGAGCATGGTTAGG + Intergenic
1072236251 10:93456552-93456574 CACATGTGCAGAGCAAGGGTGGG - Intronic
1073869622 10:107848410-107848432 CATATGTGAAGAGAATCCATAGG - Intergenic
1074553437 10:114466554-114466576 GGTATGGGCAGAGCCTGCTTCGG + Intronic
1075328947 10:121558492-121558514 CAGATGTGCAGGGCATTCTCTGG - Intronic
1076065173 10:127442742-127442764 CAGCTGTGCTCAGCATGCTTTGG - Intronic
1080109970 11:28555604-28555626 CACAGGTACAGAGCATGATTTGG - Intergenic
1086492012 11:87365056-87365078 CATATGAGCAGAGGCTGCTAGGG - Intergenic
1089936370 11:122368485-122368507 CATATTTTCAGAGAGTGCTTTGG - Intergenic
1092026736 12:5247033-5247055 CAGATGTGGAGAGCATGCTGAGG - Intergenic
1094235076 12:28154924-28154946 CATAAATGCAGTGCTTGCTTGGG - Intronic
1095503610 12:42868045-42868067 CATGTGTGAAGATCAGGCTTGGG + Intergenic
1096369261 12:51055212-51055234 AGCATGTGAAGAGCATGCTTTGG - Intronic
1097754556 12:63395301-63395323 CATAGGAACAGAGCATGCTGAGG - Intergenic
1103865562 12:124049295-124049317 CACATGTGCAAAGCATGCAGAGG - Intronic
1104763873 12:131314060-131314082 CAAATGAGCAGTACATGCTTCGG + Intergenic
1106307048 13:28522046-28522068 CATAGGTGCACAGCCAGCTTCGG + Intergenic
1107820167 13:44278506-44278528 CAGATGTGCAGAGCAAGCCTTGG + Intergenic
1107823148 13:44304520-44304542 CAAATGTGCAGGGCTGGCTTCGG - Intergenic
1108198382 13:48018055-48018077 CAGTTGTGAAGAGCATGGTTAGG - Intergenic
1113267927 13:108639955-108639977 CAGATGGGAAGAGCAGGCTTGGG + Intronic
1113608216 13:111625299-111625321 CAAATGTTCAGAACATGCTTTGG + Intronic
1113905237 13:113816393-113816415 CATGAGTGCAGAGCATGGGTCGG - Exonic
1114132778 14:19812014-19812036 TATATGTGTAGAGCATACTATGG + Intronic
1116428176 14:44815737-44815759 AATATATACAGAGCATCCTTTGG - Intergenic
1118002324 14:61535169-61535191 CATATGTGCATAGCAGGCATGGG + Intronic
1118828153 14:69403128-69403150 CCTTTGTGTAAAGCATGCTTTGG - Intronic
1122051316 14:99062388-99062410 CACATGTGCAGAGCGTGTGTCGG + Intergenic
1124916317 15:33978239-33978261 CACATGTTCAGAGGATGCTCAGG - Intronic
1126447694 15:48767384-48767406 CCTATTAGCAAAGCATGCTTTGG - Exonic
1128468775 15:67934588-67934610 CAGCTGTGCTGAGCATGCTAAGG + Intergenic
1133619750 16:7514852-7514874 CATCAGTGCAGAGCAAGCTCAGG - Intronic
1137929475 16:52573130-52573152 AATATATGCAGAACAGGCTTTGG - Intergenic
1144873702 17:18385451-18385473 CCTCTGTGCAGACCATTCTTTGG - Intronic
1145158763 17:20560330-20560352 CCTCTGTGCAGACCATTCTTTGG + Intergenic
1151422691 17:74008804-74008826 CATTTGAGGAGAGCGTGCTTAGG - Intergenic
1151625404 17:75272535-75272557 CCTCAGTGCAGAGCATGCTGCGG - Intergenic
1154458797 18:14557953-14557975 TATATGTGTAGAGCATACTATGG + Intergenic
1156753278 18:40487318-40487340 CATATGTGCAGAGAATTATCAGG + Intergenic
1157580547 18:48771634-48771656 CTTATCTGCAGGGCCTGCTTCGG - Intronic
926016708 2:9459434-9459456 CATATGTACAGTCCATGGTTTGG + Intronic
926647104 2:15301905-15301927 GGGATGTGCAGAGCATGCTGGGG + Intronic
928056117 2:28056780-28056802 CATATGAACATAGCAAGCTTTGG + Intronic
929261296 2:39869377-39869399 CATATGGGCAGAGCCTGTCTTGG + Intergenic
929320991 2:40543251-40543273 GATATTTGCTGAGGATGCTTTGG - Intronic
931288020 2:60848968-60848990 CACATGTGGAGAACCTGCTTCGG - Intergenic
933758030 2:85655791-85655813 TATATGTGCACAGAAAGCTTTGG + Intergenic
935327124 2:101947363-101947385 CATATGTGGAGAGGATGCATGGG + Intergenic
936680221 2:114761577-114761599 CCTTTGTGCACAGCATCCTTTGG + Intronic
937377229 2:121345691-121345713 CAGGTGTGCAGTGCATGGTTTGG - Intronic
937846200 2:126581853-126581875 TACATGTGCAGAACATGCATAGG - Intergenic
938105477 2:128527056-128527078 CATAAGTGGAGAGCAGGCCTGGG - Intergenic
938215314 2:129507520-129507542 AATATGTTCAAAGCATACTTTGG + Intergenic
940529780 2:154867011-154867033 CATAACTGCACAGCATGCTATGG + Intergenic
941838237 2:170049848-170049870 CATATGTTCAGTAAATGCTTTGG + Intronic
943584282 2:189719663-189719685 CAAAAGTGCAGTGCATGCTTTGG + Exonic
943824989 2:192378664-192378686 CATATTTAGAGAGCATGTTTTGG + Intergenic
946074108 2:217059705-217059727 CATCTGTGCAGTGCATGTTGGGG - Intergenic
948259991 2:236596720-236596742 CACATATGCAAAGCATTCTTAGG - Intergenic
948305331 2:236942713-236942735 CATATGTTAAGATCATGATTTGG - Intergenic
1169594468 20:7182394-7182416 CATCTGTTCTGAGCATGTTTTGG + Intergenic
1171152333 20:22838164-22838186 CATATGTGTGGAGCATTCTGGGG - Intergenic
1175174944 20:57105827-57105849 CATTTATGTAGAGGATGCTTGGG + Intergenic
1175929220 20:62485719-62485741 CCTATGTGCTGGGCACGCTTCGG - Intergenic
1176815347 21:13595346-13595368 TATATGTGTAGAGCATACTATGG - Intergenic
1179562060 21:42221672-42221694 CTTATGTGCTTAGGATGCTTAGG + Intronic
1183787409 22:40038128-40038150 CAAATGTTCAGAACATGGTTAGG + Exonic
951682581 3:25309965-25309987 AATATGTGTAGAGCAGCCTTCGG - Intronic
951766862 3:26209278-26209300 CATATCTGCATAGCATTCTACGG + Intergenic
952077533 3:29715233-29715255 CATATGTGCCAAGCATTCTGTGG + Intronic
953108141 3:39906034-39906056 CATATGTGCAGAGCATGCTTTGG + Intronic
954327535 3:49871643-49871665 CACATGCACAGAGCGTGCTTAGG - Intergenic
954865485 3:53725596-53725618 CCTCAGTGGAGAGCATGCTTTGG + Intronic
955559661 3:60175049-60175071 CATTTGTGGAGAGCATGCAGTGG - Intronic
956637188 3:71377826-71377848 CATTTGTGCATAGCATTCATAGG - Intronic
961430750 3:126881193-126881215 CAAATGTACAGAGCAAGCCTGGG - Intronic
962338420 3:134559842-134559864 GATGTGTGCAGAGCATGGCTTGG + Intronic
963756923 3:149244198-149244220 CATTTGTGCAGAGCAACCTGTGG + Intergenic
965029400 3:163344776-163344798 CATTTTTGCAGAATATGCTTTGG - Intergenic
965136612 3:164780250-164780272 CATATTTCCAGAGCATGTTAGGG + Intergenic
972635501 4:40880471-40880493 CAGATGTTCAGTGCATGGTTTGG - Intronic
973848498 4:54937365-54937387 CATATATGCATAGGATGATTTGG + Intergenic
976026522 4:80694133-80694155 CACATGTGCAGTGCATTCTTTGG + Intronic
976990179 4:91355948-91355970 GATTTTTGCAGAGCAAGCTTTGG + Intronic
977767176 4:100812805-100812827 CATATTTACATACCATGCTTTGG + Intronic
980293923 4:130884434-130884456 AAAATGTGCATAGAATGCTTGGG - Intergenic
986658574 5:10038837-10038859 GATATTTGGAGAGCATGCATTGG - Intergenic
987443869 5:17992002-17992024 AATATGTTCACAGCATGCTGAGG + Intergenic
991227119 5:64285971-64285993 CAGATGTGCATAGCAAGCGTGGG + Intronic
995693790 5:114857485-114857507 CATATGTAGAGGGCATTCTTAGG + Intergenic
1010419733 6:75659105-75659127 CATATGTGGAGATCCTGCTGAGG + Intronic
1017052248 6:150404106-150404128 CAGATGAGCAGAGGTTGCTTAGG - Exonic
1018035919 6:159881031-159881053 CATACGTTTAGAGGATGCTTGGG - Intergenic
1022956427 7:35385607-35385629 CATATTTGCAGGGCATGCCAAGG - Intergenic
1026436626 7:70404667-70404689 CATATGTGCAGAGGAAATTTGGG + Intronic
1035892986 8:3366155-3366177 CATTTGTGCATATGATGCTTTGG - Intronic
1044055701 8:87566830-87566852 CAGCTGTGCAGAACATGCTAAGG - Intronic
1046649899 8:116826307-116826329 CATATGTGCAGAGCTATCATGGG + Intronic
1048268736 8:133011075-133011097 GCTTGGTGCAGAGCATGCTTGGG + Intronic
1049751063 8:144284349-144284371 CACATGTGCACACCATTCTTGGG - Intronic
1054778654 9:69146203-69146225 TGTATGTGCAGACTATGCTTCGG + Intronic
1055424633 9:76181500-76181522 CATATTTGCAGGACATGCATTGG - Exonic
1057993556 9:99798424-99798446 TATGTGTGCAGAGGATTCTTTGG - Intergenic
1058770035 9:108221894-108221916 CAAATGGGCACAGCATGCTTCGG - Intergenic
1061456500 9:130701965-130701987 CATTTTTGCAGAGAACGCTTTGG - Intronic
1203532010 Un_GL000213v1:154080-154102 TATATGTGTAGAGCATACTATGG + Intergenic
1191713655 X:64178805-64178827 CATATGTGCAGGGCCTGCATGGG + Intergenic
1196044396 X:111242309-111242331 TACATGTGCAGAACATGCATAGG + Intergenic
1198248074 X:134850910-134850932 CATTTGTACAGGGCATGCTTTGG - Intronic
1201548395 Y:15192443-15192465 AATATAGGCAGAGCATGGTTTGG - Intergenic