ID: 953109737

View in Genome Browser
Species Human (GRCh38)
Location 3:39922352-39922374
Sequence CTACCTAGAAAAAGCTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953109729_953109737 17 Left 953109729 3:39922312-39922334 CCATCCAAACGACACAGAAAAAA 0: 1
1: 1
2: 0
3: 47
4: 471
Right 953109737 3:39922352-39922374 CTACCTAGAAAAAGCTAAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 101
953109730_953109737 13 Left 953109730 3:39922316-39922338 CCAAACGACACAGAAAAAAATCT 0: 1
1: 0
2: 3
3: 59
4: 644
Right 953109737 3:39922352-39922374 CTACCTAGAAAAAGCTAAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953109737 Original CRISPR CTACCTAGAAAAAGCTAAGC AGG Intronic
909353250 1:74678090-74678112 AGACCTAGGAAAGGCTAAGCAGG + Intergenic
910171932 1:84387036-84387058 GTATCTAGAAGAAGCTAGGCAGG - Intronic
911481488 1:98447595-98447617 TTAACTAAAAAAAGCAAAGCTGG - Intergenic
918253645 1:182727107-182727129 ATACCTAGAAAATGCTTAGGTGG - Intergenic
918640069 1:186829097-186829119 CTACCAAGTAAAAGCTAAGGAGG - Intronic
1068991499 10:63155684-63155706 CTACCCAGAAAAACTTTAGCTGG + Intergenic
1070988922 10:80714562-80714584 CCACCTAGAAAAAGAGAAACAGG - Intergenic
1071239731 10:83692243-83692265 CTACATAGAAAAAGACAACCTGG - Intergenic
1073960588 10:108922335-108922357 CTAGAGAGGAAAAGCTAAGCCGG + Intergenic
1081227311 11:40540208-40540230 GCACTTAGAAAAAGCTAAGAGGG - Intronic
1081681352 11:45007149-45007171 CCTTCTAGAAAAAGATAAGCAGG + Intergenic
1083402331 11:62432356-62432378 TTACCTAGAAACAGAAAAGCAGG - Intergenic
1083975556 11:66116994-66117016 CTGGGTAGAAAAAACTAAGCAGG + Intronic
1084882796 11:72183761-72183783 GATCCTAGAAAAAGCTAACCTGG + Intergenic
1089710346 11:120310077-120310099 CTAGCCAGAGAAAGCTGAGCTGG + Intronic
1092264028 12:6967729-6967751 CTTGGTAGAAAAAGCAAAGCAGG - Exonic
1093439595 12:19178604-19178626 CTCACTAGAAAGAGGTAAGCAGG - Intronic
1093950681 12:25162778-25162800 CTTCCTCTAAAAAGCTCAGCTGG + Intronic
1102236751 12:111298568-111298590 CAACCTGGAGAAAGCTAATCAGG + Exonic
1107637983 13:42412308-42412330 CTACCTTGAGAAAGCCAGGCTGG - Intergenic
1109388816 13:61667378-61667400 CCATCTAGAAAGAGATAAGCAGG + Intergenic
1118681553 14:68246563-68246585 CTGCCTAGAAAAAGCCCAGCTGG - Intronic
1120314312 14:82872142-82872164 CCATCTAGAAAAAGGGAAGCAGG - Intergenic
1122378181 14:101282260-101282282 CTATTTAGAAAAAGATAAACTGG + Intergenic
1122762053 14:104036030-104036052 CTACTTAGAAAAAGCTGAATGGG + Intronic
1127048233 15:55050804-55050826 CTAGATAGAAAAAGCAAAGAGGG + Intergenic
1131686063 15:94768898-94768920 GTACCTTTAAAAAGCTAAGTCGG - Intergenic
1132241734 15:100263029-100263051 GTATATAGATAAAGCTAAGCTGG + Intronic
1133693753 16:8241044-8241066 TTACAAAGAAAAAGCTAAGATGG + Intergenic
1135689703 16:24526392-24526414 ATTCCTAGAAAAAGCAAAACTGG + Intergenic
1139173500 16:64659825-64659847 CAACCAAAAAAAAACTAAGCCGG - Intergenic
1143971313 17:10798036-10798058 GTGTCTAGGAAAAGCTAAGCAGG - Intergenic
1144078229 17:11737987-11738009 TTACTTAGAACAAGCTCAGCAGG + Intronic
1147502512 17:40979096-40979118 ATAGCTAGAAAAGGGTAAGCAGG - Intronic
1148095111 17:45047284-45047306 CTGCCTCGAAAAAAATAAGCTGG - Intronic
1149708550 17:58717778-58717800 CACCTTAGAAAAAGCTAAGCAGG - Intronic
1153577661 18:6538999-6539021 GTACCTAGTAAGAGCTAAGAGGG - Intronic
1154277442 18:12974576-12974598 CTACTTAGAAAAAGATAAACAGG - Intronic
1157363821 18:47044940-47044962 CCACCTAGATAAAACTAATCTGG - Intronic
1160469908 18:79121373-79121395 CTCCCTAGAAAAATCAAAACTGG - Intronic
1163879190 19:19902576-19902598 CTCCCCAGAAAAAGCTAAATAGG - Intronic
1164196444 19:22968021-22968043 CTACATATACAAAGATAAGCTGG - Intergenic
1164720090 19:30425582-30425604 CTACCAAGAAGAGTCTAAGCGGG - Intronic
1165556962 19:36642462-36642484 TTACCTTGAAACAGCTATGCTGG - Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
925131473 2:1496937-1496959 CTACCTAGAAAAAGGCCAGCTGG - Intronic
925818549 2:7777050-7777072 CTGCTTAGAAAGAGCTAAGCTGG + Intergenic
930362260 2:50396480-50396502 CTACCTAGTAAAATTCAAGCAGG - Intronic
931277928 2:60760519-60760541 CTACTGAGAAAAAGCTGAGGGGG + Intronic
936045855 2:109187380-109187402 TTATTTAGAAAAAGCTAAGATGG + Intronic
942063475 2:172248783-172248805 CTAGCTACAAAGAGCTCAGCTGG - Intergenic
942529688 2:176896253-176896275 CTGCATAGAAAAAGCAAACCTGG - Intergenic
1168860006 20:1039354-1039376 CTACCAAGAAATAGCAATGCAGG - Intergenic
1169299099 20:4426704-4426726 CTAGCTAGAATAATCTAGGCTGG - Intergenic
1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1175843493 20:62046406-62046428 AATTCTAGAAAAAGCTAAGCTGG - Intronic
1178017994 21:28374068-28374090 ATACCTAGAAATAGCCAAACAGG - Intergenic
1182673473 22:32017712-32017734 TTGCCTAGCAAAAGCTAAGAGGG - Intergenic
952164092 3:30727268-30727290 CTACCAAGAAAAAACTAATATGG + Exonic
952374923 3:32758435-32758457 CTTCCTATAAAAAGCACAGCTGG - Intronic
953109737 3:39922352-39922374 CTACCTAGAAAAAGCTAAGCAGG + Intronic
957288593 3:78248716-78248738 CTATCTAGAAAAAGGGAGGCAGG - Intergenic
962817365 3:139013933-139013955 TTTCCTAGAAAAAACAAAGCTGG - Intronic
963002249 3:140692950-140692972 CTACCTAAGAAAAGCCAAGAGGG - Intronic
965935728 3:174108478-174108500 ATTGTTAGAAAAAGCTAAGCTGG + Intronic
967340808 3:188395526-188395548 CTATTAAGAAAAAGCTCAGCTGG - Intronic
972487903 4:39559814-39559836 TTCCCTAGAAACAGCTAAACAGG + Intronic
973019380 4:45182735-45182757 GTACCTAGGAAAAGCTAACTAGG - Intergenic
973612593 4:52650796-52650818 ATACCAAGAAAAAGTTAAGTTGG + Intronic
976148723 4:82070985-82071007 TCATCTAGAAAAAGTTAAGCAGG - Intergenic
977023184 4:91782331-91782353 ATACCTATAAAAACCTCAGCAGG + Intergenic
977412478 4:96685853-96685875 GCAAATAGAAAAAGCTAAGCCGG + Intergenic
977505173 4:97893084-97893106 CTAACTGGAAGAAGCTAAGCAGG - Intronic
979522221 4:121680805-121680827 CTGCCTATAAAAAGAGAAGCAGG + Intronic
981407717 4:144391539-144391561 CTGTCTAGAAAAAGCTGGGCTGG + Intergenic
982121831 4:152150456-152150478 CTACCCAGAAAGAGCTAACAGGG + Intergenic
982779741 4:159478342-159478364 CTACCAAGCAAAAACTATGCAGG - Intergenic
988427993 5:31086257-31086279 CTGCCTTTAAAAAGCTAGGCTGG - Intergenic
990432358 5:55748587-55748609 TTATCTAGAAGAAGGTAAGCAGG - Intronic
991603271 5:68374652-68374674 ATACATAGAAAAAGCAAAGTTGG - Intergenic
992637525 5:78739184-78739206 CTGCCAAGACAAAGCTAAGGAGG - Intronic
1002019530 5:176354091-176354113 CTACTAAGAGAAAGTTAAGCAGG + Intronic
1002574309 5:180163124-180163146 CTACCTAGAAAATCCAAAGGGGG - Intronic
1003947017 6:11085191-11085213 CTACATAGAAAGAGCTTACCTGG - Intergenic
1005384162 6:25269264-25269286 ATACATAGAAAATCCTAAGCAGG - Intergenic
1008546792 6:52590267-52590289 CTACCTAGAAACAGCAGAGCTGG - Intergenic
1010093788 6:72015431-72015453 CTATATAGAAAATTCTAAGCAGG - Intronic
1010727800 6:79354961-79354983 CTACCTTTAAAAAGCCAAGTTGG - Intergenic
1013697078 6:112716105-112716127 CTACCTGGAAAATGTTGAGCTGG + Intergenic
1015183626 6:130387885-130387907 CTACCTTGAAAAAGGCAAACAGG - Intronic
1015422858 6:133031157-133031179 CTACCTAGAAAATGAAAAGAAGG - Intergenic
1018337039 6:162803490-162803512 TCAACTAGAAAAAGCAAAGCTGG + Intronic
1027668325 7:81067067-81067089 CTTTCTAGAAATAGCTAAGCAGG + Intergenic
1045467022 8:102479545-102479567 CTACCTAGAAAAAGCCTGGAGGG - Intergenic
1050063237 9:1732153-1732175 CCACCTAGAAAAGGCCAAGCTGG - Intergenic
1052026203 9:23576156-23576178 CTACACAGATAAAGCTAAGCTGG + Intergenic
1053792046 9:41693593-41693615 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054153110 9:61621172-61621194 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054180451 9:61905613-61905635 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054472904 9:65552376-65552398 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054825504 9:69568903-69568925 ATACCTCTAAAAAGCTTAGCTGG - Intronic
1055910270 9:81342806-81342828 GTACCTAGAAAAAGGAAAGAGGG - Intergenic
1057079042 9:92158658-92158680 CAACCTCGAAGAAGCTGAGCAGG - Intergenic
1059455012 9:114394927-114394949 TTCCCCAGAAAAAGCTGAGCTGG + Intergenic
1186327288 X:8493560-8493582 GTACCTGGAAATAGCTAACCAGG - Intergenic
1187753098 X:22489013-22489035 CAACCCAGAAAAAGCCAAACAGG - Intergenic
1188779929 X:34269342-34269364 CTACATAGAAAGAGAAAAGCTGG + Intergenic
1188984713 X:36758851-36758873 CAACCTAAACAAAGCCAAGCAGG - Intergenic
1189620933 X:42836761-42836783 CTACCTAAAAAAATATAAGAGGG + Intergenic
1192302393 X:69918657-69918679 CTTCACAGGAAAAGCTAAGCTGG - Intronic
1192801312 X:74467168-74467190 CCATCTAGAGAAAGCTAAGCTGG + Intronic
1193368793 X:80667277-80667299 CTAGCTAGATAAAGCACAGCAGG - Intergenic
1195038467 X:100991802-100991824 CTGCCTACAAAAAGCAGAGCAGG + Intergenic