ID: 953121169

View in Genome Browser
Species Human (GRCh38)
Location 3:40044057-40044079
Sequence AAGCAGAAGCTGGATGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 796}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953121160_953121169 10 Left 953121160 3:40044024-40044046 CCATTTCCCCTACCTTGGTTTCC 0: 1
1: 0
2: 4
3: 45
4: 520
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121161_953121169 4 Left 953121161 3:40044030-40044052 CCCCTACCTTGGTTTCCCAGTGA 0: 1
1: 0
2: 1
3: 15
4: 198
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121162_953121169 3 Left 953121162 3:40044031-40044053 CCCTACCTTGGTTTCCCAGTGAG 0: 1
1: 0
2: 2
3: 13
4: 174
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121159_953121169 11 Left 953121159 3:40044023-40044045 CCCATTTCCCCTACCTTGGTTTC 0: 1
1: 0
2: 1
3: 21
4: 283
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121164_953121169 -2 Left 953121164 3:40044036-40044058 CCTTGGTTTCCCAGTGAGCTGAA 0: 1
1: 0
2: 0
3: 21
4: 364
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121156_953121169 17 Left 953121156 3:40044017-40044039 CCTCCTCCCATTTCCCCTACCTT 0: 1
1: 0
2: 6
3: 107
4: 1010
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121158_953121169 14 Left 953121158 3:40044020-40044042 CCTCCCATTTCCCCTACCTTGGT 0: 1
1: 0
2: 1
3: 21
4: 255
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796
953121163_953121169 2 Left 953121163 3:40044032-40044054 CCTACCTTGGTTTCCCAGTGAGC 0: 1
1: 0
2: 3
3: 304
4: 5480
Right 953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG 0: 1
1: 0
2: 3
3: 85
4: 796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953121169 Original CRISPR AAGCAGAAGCTGGATGAGGA AGG Exonic
900287983 1:1910886-1910908 AGGCAGAAGCTGCACAAGGAAGG + Intergenic
900409626 1:2506851-2506873 AAGCCGGAGCTGGAGCAGGAGGG - Intergenic
900708392 1:4094803-4094825 CACCAGCAGCTGGATGAGGCTGG + Intergenic
900763306 1:4487280-4487302 CAGCAGGAGCTGGAAGAGGCAGG - Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902193108 1:14777538-14777560 AAGCAGATGCTGGGTGAAGTTGG - Intronic
902643410 1:17781093-17781115 CCCCAGAAGCTGGAAGAGGAAGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903364700 1:22798833-22798855 AGGCAGGAGCAGGATGAGAAGGG + Intronic
903570107 1:24297931-24297953 AAGCAGGAGGAGGAGGAGGAGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904602961 1:31683815-31683837 AGGAAGAAGCTGGAGGAGAAGGG - Intronic
905046891 1:35011328-35011350 CATCAGAAGCTGGTTGATGATGG - Intronic
905388509 1:37621217-37621239 AAGCAGGGGCTGGATGAGGAAGG + Intronic
905520249 1:38593541-38593563 CACCAGAAGCTGGAAGAGCAAGG - Intergenic
905612902 1:39370573-39370595 AAGCAGAGGCTGGATAATTACGG - Intronic
906127790 1:43438149-43438171 AAGCAGGAGCTGCATGGGAAGGG + Intronic
906346086 1:45015358-45015380 AAGCAGATGCTGGATGACTTTGG + Exonic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906753308 1:48285727-48285749 AAGCTGAAGCTGGGTGGGGCGGG - Intergenic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
907650658 1:56291724-56291746 AAGCAGCAGCTGGAAGTGCAGGG - Intergenic
907873692 1:58465964-58465986 AAGCAGAAGCCAGATGTGCAGGG + Intronic
908156680 1:61360521-61360543 AAGCAAAAGCTGGGGAAGGATGG - Intronic
908356446 1:63328341-63328363 AGGAAGAAGCGGGATGAGAAAGG + Intergenic
908418437 1:63935729-63935751 AAACAGCAGCTGGAGCAGGAAGG + Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908640039 1:66212440-66212462 AAGCAAACGCTAGAAGAGGAGGG - Intronic
908988457 1:70055257-70055279 AAGCAGAAGCCGGATCATGCTGG + Intronic
909177740 1:72381485-72381507 AAGCAGAAGCTGGAACAGTTTGG - Intergenic
909264887 1:73544566-73544588 AAGCATATGCTTGATGATGAGGG - Intergenic
909362732 1:74782895-74782917 AAGAAGAAGCGGGAGGAGAAGGG - Intergenic
910228356 1:84960599-84960621 CAGCACAAGCTGGATGATGTGGG - Intronic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
912330396 1:108815036-108815058 AAGCAAAAGCTTGATCTGGAAGG + Intergenic
912569934 1:110613936-110613958 GAGCAGAAGCTGGAAGACCACGG - Intronic
912740947 1:112196978-112197000 AAGCAAATTCTGGGTGAGGAGGG - Intergenic
912798970 1:112709382-112709404 AAGCAGTGGCTGGATCATGAAGG + Intronic
912863103 1:113232507-113232529 ATCCTGCAGCTGGATGAGGAGGG - Intergenic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
913447139 1:118961556-118961578 AAGCAGAAGCTTGATGATGGAGG + Intronic
913962226 1:143349227-143349249 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914056582 1:144174801-144174823 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914122564 1:144791561-144791583 CAGCAGAAACTGGAAGAGGCTGG - Intergenic
914440569 1:147702197-147702219 AAAGAGAAGCTGGATGATGATGG + Intergenic
914887014 1:151593832-151593854 AAGCAGAAGCGGTTTGGGGAGGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915479500 1:156175287-156175309 TAGCAGAAGCTGGCTGAGAAGGG - Intronic
916036866 1:160929943-160929965 TAGCAGAAGCTGCATAAGTATGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916462731 1:165044059-165044081 AAGTAGAGGTTGGATGATGATGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917186526 1:172362745-172362767 GGCCAGAAGCTGGATTAGGAGGG - Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
921127570 1:212190992-212191014 CAGCGAAAGCTGGATGAGAAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921523392 1:216186282-216186304 AAGCAGAAGCTGGAACATGAAGG - Intronic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
923155716 1:231277429-231277451 AAGGAACAGCTGTATGAGGAAGG + Intronic
923221352 1:231897064-231897086 AAGAAGGAGCTGGAAGGGGAAGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063290730 10:4744246-4744268 CAGCAAAAGCTGGGTGAGGCAGG + Intergenic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1063608777 10:7545468-7545490 AACCAGGAGCTGGAGGAGGCAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064357683 10:14634645-14634667 AGGCAGAAACTGGAGCAGGAAGG + Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065328461 10:24570440-24570462 GAGCAGAAGCTTGATGGGCAGGG + Intergenic
1065502693 10:26397786-26397808 AATCAGAATCTGAATGAGGGTGG - Intergenic
1065641521 10:27787338-27787360 AGGCAGAAGGTGGAGGAGGGAGG - Intergenic
1066353951 10:34664092-34664114 CGGCAGAAGCGAGATGAGGAAGG - Intronic
1066446279 10:35486686-35486708 AGGCAGAGGCTGGATCACGATGG - Intronic
1066481281 10:35798101-35798123 CAGCAGGAGCCTGATGAGGAGGG + Intergenic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067182415 10:43998633-43998655 AAGCAAAAGCTGGAAGAGAAAGG + Intergenic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067479262 10:46584691-46584713 AAGCAGAAACTGGATGGTCAGGG - Intronic
1067615477 10:47757110-47757132 AAGCAGAAACTGGATGGTCAGGG + Intergenic
1067789068 10:49273859-49273881 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1068594947 10:58892746-58892768 AAGCAGAAGCACCTTGAGGAAGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1070252783 10:74787623-74787645 AAGCAGATGCGGGAAGAGCAGGG + Intergenic
1070432262 10:76352659-76352681 ATGCAGAAAGTGGATAAGGAGGG + Intronic
1071368195 10:84923045-84923067 AAGGAGAAGCTAGAAAAGGATGG + Intergenic
1071811582 10:89187549-89187571 AAGCAGATACTGGAGGAGGCAGG + Intergenic
1071990244 10:91094207-91094229 AAGCAGAAGTTGGAAGAGTGTGG - Intergenic
1072277141 10:93834410-93834432 AAGCAGAAACTGGAAGAGTGTGG - Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072631625 10:97150691-97150713 AAGCAGCTTCTGGATGACGAGGG + Intronic
1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG + Intronic
1073440200 10:103547985-103548007 CACCAGAACCTGGATGGGGAGGG - Intronic
1073708304 10:106011553-106011575 ACGCAGCAGCTGCCTGAGGATGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074422519 10:113322026-113322048 AAGCAGAACCTGGGGGAGGGGGG + Intergenic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1074505169 10:114063348-114063370 AGGCAAAAGCTGGATTGGGAAGG + Intergenic
1074866706 10:117548104-117548126 AGGCAGAAGCTGGAGGAAGAAGG + Exonic
1075058934 10:119241150-119241172 AAGCTGAGGCCGGAGGAGGAGGG - Intronic
1075125836 10:119698187-119698209 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
1075546680 10:123360289-123360311 AAGCAGGAGTTGGATGATAAAGG - Intergenic
1075755927 10:124811302-124811324 AAGCATAATCTGGAAGATGAAGG + Intronic
1075773967 10:124967461-124967483 AAGCAGAGGCTGGATTACGAAGG + Intronic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1076122122 10:127944604-127944626 AGGCAGAAACTGGATCATGAAGG + Intronic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077109722 11:856759-856781 AATCAAAAGCAGGATGAGCAGGG - Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1077809144 11:5619998-5620020 AAGCAGAAGTTGCATGAGTCAGG - Exonic
1078479878 11:11666324-11666346 AACCAAAAGCTGGATAAAGAAGG + Intergenic
1079210673 11:18458082-18458104 AAGCAGCAGCTGGCAGAGGTAGG - Intronic
1079237798 11:18702069-18702091 CTGCAGGAGCTGGATCAGGATGG + Exonic
1079699786 11:23530190-23530212 AAGCATAAACTGGATGTTGATGG - Intergenic
1080014163 11:27487334-27487356 AAGCAGAAGCTGGATTATGCAGG + Intergenic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080561055 11:33463117-33463139 AAGAAAAAGCTGGCTGAGCATGG - Intergenic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081831782 11:46120995-46121017 AAGCAGGAGGAGGAGGAGGAGGG + Exonic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082680799 11:56166550-56166572 AAGGAAAAGATGGATGAGAAGGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1084045937 11:66567917-66567939 AAGCAGCAGTTGGATGATGACGG - Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085651044 11:78268974-78268996 AAGCAAGAGATGGAGGAGGAAGG + Intronic
1085699033 11:78729820-78729842 AAGCAGGAGGAGGAGGAGGAAGG + Intronic
1086630814 11:89017602-89017624 AAGCAGAAGCTGAATGGCCAAGG + Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087084204 11:94199926-94199948 AAGCAGAAGCTCCAAGAGAAAGG + Intergenic
1087610776 11:100431898-100431920 AAGCAAAAGTGGGATGAGGGAGG + Intergenic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088751579 11:112846600-112846622 AAGCAGAAGCTGGAACATCAAGG - Intergenic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089380906 11:118030752-118030774 GAGCCAAAGCAGGATGAGGAGGG + Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090245908 11:125215807-125215829 AAGCAGAGGCTGGAAGTGAAAGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091406483 12:212806-212828 CAGCCGAAGCTGGAGGTGGAAGG - Intronic
1091447504 12:552453-552475 AAGCTGAACCTGCAGGAGGAAGG - Exonic
1091661908 12:2390593-2390615 AAGCAGAAGAGGGATGAGTTTGG + Intronic
1091678339 12:2507924-2507946 GAGCAGAAGCTGCAGTAGGAAGG + Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091906026 12:4189755-4189777 ATACAGAGGCTGGATGAAGAGGG + Intergenic
1091922198 12:4314082-4314104 CGGCTGGAGCTGGATGAGGAGGG + Intergenic
1091950936 12:4592520-4592542 AATCTGCAGCTGGATCAGGAAGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093176423 12:15918190-15918212 AAGCACCAGCGGGATGAGGAAGG - Intronic
1093732537 12:22582234-22582256 AAGGAGTAGGTGGAAGAGGAGGG + Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094447758 12:30550213-30550235 AAGCAGGAGGAGGAAGAGGAGGG - Intergenic
1095499239 12:42818385-42818407 TACCAGATGATGGATGAGGAAGG - Intergenic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096298217 12:50401665-50401687 AAGCAGCAGCTGCGTGATGAAGG + Intronic
1096520207 12:52180736-52180758 AAAAAGGAGCTGGATGGGGATGG + Intronic
1096544715 12:52329766-52329788 AAGCAGAAGCTTGCACAGGATGG - Intergenic
1096590412 12:52655278-52655300 CAGCAGGGGCTGGAAGAGGAGGG - Intergenic
1097341091 12:58439015-58439037 AAGAAGAAGGTGGAAGTGGAAGG + Intergenic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1099218876 12:79888500-79888522 AAGCAGTAGCTTGAAGAGGCAGG + Intronic
1099389300 12:82059405-82059427 AGGAAGAGGCTGGAGGAGGAGGG + Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099873444 12:88375998-88376020 ATGCAGAAGCTGGGTGAGCGTGG - Intergenic
1100602061 12:96120655-96120677 AAGAAAAAGATGGAAGAGGAGGG + Intergenic
1100867156 12:98869155-98869177 AACCATAAGCTCCATGAGGAAGG + Intronic
1101125945 12:101633773-101633795 AAGCAGAGGCTGGATGGCCATGG + Intronic
1101980154 12:109399051-109399073 GAGCAGCAGCTGTATGAGCACGG + Intronic
1102167957 12:110821025-110821047 AAGAAGAAGGTGGAGGGGGAGGG - Intergenic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1103730837 12:123026773-123026795 CAGCAGCAGCTGGAAGAGGCAGG - Intronic
1104092901 12:125530649-125530671 CAGCGGAAGCTGGAAGAGGCAGG - Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106086489 13:26546913-26546935 AAGCATGAGCTTGATGAAGAGGG - Intergenic
1106920333 13:34556431-34556453 AAGCAGAAGTGGGATTAAGATGG + Intergenic
1107212223 13:37870550-37870572 AAGACCAAGCTGGATGAGGGTGG - Intergenic
1107522841 13:41200714-41200736 GAGCAGTAGCTGGGTGAGGTAGG - Intergenic
1107534465 13:41314562-41314584 CAGCAGGGGCTGGATGTGGAAGG - Intronic
1108956762 13:56167633-56167655 AAGCAGAGGCTGGAGGAGTTTGG - Intergenic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1109956631 13:69576455-69576477 AAGCAAAAGCTGTTTGAAGAGGG + Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1112016677 13:95336951-95336973 ATGCAGAACTTAGATGAGGAAGG + Intergenic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1113084199 13:106550748-106550770 CACCAGAAGCTGGAAGAGGCAGG - Intronic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113472535 13:110557166-110557188 TATCAGAAGCTGGAGGAGGGAGG + Intronic
1113749100 13:112766312-112766334 AAGCAGAAGAGGGATGAGTAAGG + Intronic
1113778406 13:112961924-112961946 AGGCAGAAACTGGAGGAGGTGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114056018 14:18967480-18967502 AAGCAGATGGTGGCTGAGGCTGG + Exonic
1114106531 14:19434273-19434295 AAGCAGATGGTGGCTGAGGCTGG - Exonic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114852551 14:26398826-26398848 AGGCTGAAGCTGGAGGAGGATGG - Intergenic
1114996162 14:28354852-28354874 AAGCAGAGGCTGGCTGAGTTGGG + Intergenic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115428694 14:33290922-33290944 AAGCAGATTCTGGATTAGAAGGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116253432 14:42517483-42517505 AGGCAGAAGGTGCAAGAGGAAGG + Intergenic
1116747869 14:48844958-48844980 CAGCAGAAGGTGGAAGAAGATGG + Intergenic
1117454524 14:55884100-55884122 GAGCAGAAGCTGCCAGAGGAAGG - Intergenic
1117463619 14:55971225-55971247 AAGCAGAGGTTGGATTATGAAGG - Intergenic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118839970 14:69502621-69502643 AAGAAAAAGCAGGATGATGATGG + Intronic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119543514 14:75455929-75455951 CAGCAGAGCCTGGATGCGGAAGG - Intronic
1119661670 14:76456640-76456662 AGGAACAGGCTGGATGAGGATGG + Intronic
1120385934 14:83845885-83845907 AAGCAGTAGCTGGACAAGCAAGG - Intergenic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121220538 14:92281601-92281623 TAGCAGAAAATGGATGAAGAGGG - Intergenic
1121418773 14:93797813-93797835 ACGCAGAAGCTGTGGGAGGAAGG + Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1122197091 14:100096363-100096385 AAGCAGAGTCTGGATGAGGCCGG - Intronic
1122282066 14:100629378-100629400 AAGCAGAAGCTCGCTGAGGCTGG + Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122459675 14:101884645-101884667 GAGCAGAGGCTGGCTGGGGAGGG - Intronic
1124148880 15:27159094-27159116 TAGCAGAACATGGAGGAGGAGGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124618064 15:31256773-31256795 CAGCAGGAGCTGGATGATTAGGG + Intergenic
1124661453 15:31553829-31553851 GAGAAGAAGCTGGAAGAGCAGGG - Intronic
1125352328 15:38780941-38780963 AATCAGAAGCTGAAGGAGAAGGG - Intergenic
1125446169 15:39759731-39759753 CATCAGAAGCTGGAAGAGGGAGG - Intronic
1125685289 15:41559890-41559912 AAGCAGAACCTTGGAGAGGATGG + Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126668999 15:51099286-51099308 AGGCAGAGGGTGGATGAGGCTGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128527728 15:68423824-68423846 AAGCCCAGGCTGGGTGAGGAAGG - Intronic
1128592677 15:68915438-68915460 AAGCAGAAGCTGTCTGTGAATGG + Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1130558854 15:84943416-84943438 ATACAGAAGATGCATGAGGAGGG - Intronic
1130559388 15:84946608-84946630 ATACAGAAGATGCATGAGGAGGG - Intergenic
1130647308 15:85740615-85740637 AAACAGAAGCTGTATTAGGAAGG - Intronic
1131307415 15:91257795-91257817 GAGCATAATCTGGATGAAGATGG - Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1131823934 15:96301281-96301303 AGGCAAAATGTGGATGAGGAGGG + Intergenic
1132311552 15:100861439-100861461 GAGCAGAAGCTGTCTGTGGAGGG - Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133474659 16:6108727-6108749 CACCAGAAGCTAGAAGAGGAAGG - Intronic
1133737519 16:8627270-8627292 AAGCAGAGGCTGGGTCAGGCTGG - Intronic
1135078486 16:19414093-19414115 GAGCAGACGCTGGAACAGGAAGG - Intronic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135198638 16:20417533-20417555 AACCAGGAGCTGGAGGAGGAGGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1136231374 16:28887542-28887564 CAGCAGAAGCTGGATGAGTTTGG + Exonic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136555653 16:31006361-31006383 AAGCAGAGGGAGGATGAGAAAGG - Intronic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137580322 16:49629964-49629986 AAGCTGAAGCTGGATGCGTCAGG + Intronic
1138402896 16:56762795-56762817 AATCAGAAGCCAGAAGAGGAAGG - Intronic
1138470908 16:57235381-57235403 AAGCAGCTGCTTGATGTGGAAGG + Intronic
1139490437 16:67283163-67283185 AGGCAGAAGAGGGTTGAGGATGG + Intronic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1139589092 16:67923372-67923394 AAGCAGGGGCTGTAGGAGGAGGG - Intronic
1139595029 16:67952430-67952452 AACAAGAAGATGGATAAGGAGGG + Intronic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1140948947 16:79797523-79797545 CACCAGAAGCTGGAGGAGGCCGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141193587 16:81842720-81842742 AATCAGTAGCGGGAGGAGGAAGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141685616 16:85568206-85568228 AAGCAGACCCTGGAAGAAGATGG - Intergenic
1141716455 16:85729806-85729828 TATCAGAAGCTGGAAGAGGCAGG + Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142218627 16:88841989-88842011 AAACAGAAACTGGATAAGAAGGG + Intronic
1142256278 16:89015273-89015295 TAGCAGGGGCTGGATGAGGAGGG + Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143869468 17:9947897-9947919 AAGCAGGAGGAGGAAGAGGAGGG - Intronic
1144718056 17:17447954-17447976 CACCAGAAGCTGGAGGAGGTAGG + Intergenic
1145207090 17:20990338-20990360 CACCAGAAGCTGGAGGAGGCAGG - Intergenic
1145282000 17:21475026-21475048 CAACAGACGCTGTATGAGGAGGG - Intergenic
1146017656 17:29246882-29246904 CAGCAGGAGCTGGGTGAGTAAGG + Exonic
1146458002 17:33022044-33022066 GAGCAGAAGCTGGCCCAGGATGG + Intronic
1146968141 17:37050286-37050308 CAGCAGAAGCTAGATCGGGAAGG - Intronic
1147181795 17:38691179-38691201 AGGCAGGACCTGGAAGAGGAAGG + Intergenic
1147331082 17:39699999-39700021 AAGGAGGAGGTGGAGGAGGAGGG + Intronic
1147412995 17:40267323-40267345 GAGCCTAAGCTGGGTGAGGAGGG + Intronic
1147443462 17:40461267-40461289 AGGCAGACCCTGGATGGGGAGGG + Intergenic
1148195060 17:45707276-45707298 AGGCTGGAGCTGGATGAGCAGGG + Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148679112 17:49463158-49463180 AGGCAGAAGCTGGATCACCAAGG - Intronic
1148905870 17:50911798-50911820 AGGCAGAAGCTCGGTGGGGAGGG + Intergenic
1149306662 17:55354173-55354195 AGATAGAAACTGGATGAGGAGGG + Intergenic
1149351767 17:55796044-55796066 AAACAGAAAGTGAATGAGGATGG + Intronic
1149354756 17:55828365-55828387 AGGCAGAAACTGGAAGAGGCAGG - Intronic
1149873663 17:60207139-60207161 AAACAGAAGCAAGATGAGAAGGG + Intronic
1150087448 17:62284395-62284417 AAACAGAAGCAAGATGAGAAGGG + Intergenic
1150854638 17:68740357-68740379 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
1151318853 17:73340533-73340555 AAGCAGAAGCTGGACCAAGATGG - Intronic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151897670 17:76991258-76991280 AAGCAGGAGCTGGGCCAGGAAGG - Intergenic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152682141 17:81674043-81674065 AAGCAGCAGCTGGAAGGGGGTGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1152936704 17:83142422-83142444 GAGGAGAATGTGGATGAGGAAGG + Intergenic
1153396716 18:4630306-4630328 ATGCAGAAGCTGGAAGCAGAAGG + Intergenic
1154156354 18:11947539-11947561 AAGCAGAAGCCCGTTGGGGAGGG - Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157590935 18:48836131-48836153 AAGCAGCTGCTGGGGGAGGAGGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157793640 18:50556248-50556270 AGGCAGCAGCTGGAGGAGAATGG + Intergenic
1157807185 18:50666792-50666814 AAGCAGAAAGTGTATGAGGGAGG - Intronic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159356520 18:67343464-67343486 AAGCAGGAACTGGAGGAGGGAGG + Intergenic
1159893550 18:73975180-73975202 AAGTTGAAGTTTGATGAGGAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160257518 18:77259791-77259813 AAGCAGAGGCGTGATGAGAAGGG + Intronic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160734150 19:654164-654186 AAGCACAGGCTGGGTGGGGAGGG + Intronic
1161597362 19:5157436-5157458 CACCAGAAGCTGGAAGAGGTGGG - Intergenic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1162864908 19:13538351-13538373 AAGCAGAAGCTGGGAGGGGGAGG + Intronic
1163160277 19:15460135-15460157 ATGCAGGAGGTGGAGGAGGAGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163398168 19:17076053-17076075 AAGGAGAAAGTGGATGGGGATGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165303424 19:34987840-34987862 CAACAGAAGCTGGAAGAGGCAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
1166749259 19:45156950-45156972 AAGTAGAGGGTGGATGAGGTGGG - Intronic
1167301396 19:48680051-48680073 AAGTAGAAGGTGGAGAAGGAAGG - Intergenic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1202696063 1_KI270712v1_random:127486-127508 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925549607 2:5057834-5057856 AGACAGAAGCTAAATGAGGAAGG - Intergenic
925847900 2:8050462-8050484 AAGCCCAAGCAGGCTGAGGAGGG - Intergenic
926820444 2:16846130-16846152 AAGCAGAGGGTGGAGGAGCAGGG - Intergenic
927247408 2:20968590-20968612 AGGTTGGAGCTGGATGAGGAAGG - Intergenic
927384328 2:22515729-22515751 CAGCAGGAGCTGGAGGAGAAGGG - Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927640321 2:24841659-24841681 AAGAGGATGCTGCATGAGGAAGG + Exonic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928861083 2:35857643-35857665 AAGCAGCAGCTAAATGAGGCGGG - Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929022445 2:37566892-37566914 CAGCAGGATCTGGATGAGGCAGG + Intergenic
929914765 2:46125510-46125532 AAGAAGAGGCTGGGGGAGGATGG + Intronic
929944531 2:46360624-46360646 AACCAGAGCCTGGATGTGGAAGG - Exonic
930103118 2:47618140-47618162 AGGCACCAGCTGGGTGAGGAGGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930767400 2:55097947-55097969 AGGCTGAAGGTTGATGAGGAGGG - Intronic
930818534 2:55622463-55622485 AGGCAGAAGCAGGATGAAAAGGG - Intergenic
931601908 2:64012750-64012772 AAGTAGTAGCTGGAGGAGGCAGG - Intronic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
932569805 2:72932638-72932660 GAACAGATGCTGGAGGAGGAGGG + Intronic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
932580940 2:72992370-72992392 AAGGAGACACTGGATGAGGCTGG + Intronic
933085008 2:78045244-78045266 AAGCAGAAGCTGGAACAGTTTGG + Intergenic
933197861 2:79412786-79412808 AAGGAGAAACTGGATGGTGAAGG + Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933793490 2:85902331-85902353 CAGCAGAACATGGATTAGGATGG - Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934294450 2:91730994-91731016 AAGCAGAATTTGGAGGAGCATGG + Intergenic
934742422 2:96734447-96734469 AAGAAGAATCTGCATGGGGATGG - Exonic
934819399 2:97359060-97359082 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935692174 2:105741982-105742004 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
937065358 2:119013022-119013044 AAGCAGACACTGCAGGAGGAGGG + Intergenic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937357289 2:121206004-121206026 AAGAAGAATCTGGAGGAGGTGGG + Intergenic
937524711 2:122754371-122754393 AAGCAGAAAAGGGATGAGGAAGG - Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937939748 2:127275858-127275880 AAGCAGAAGCTGGAGCCGGCAGG + Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938137873 2:128774143-128774165 AAGGAGAAGATGGATGAGCTCGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938701741 2:133885716-133885738 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
939122961 2:138140447-138140469 AAGCCAAGGCTGCATGAGGACGG - Intergenic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
940012962 2:149073839-149073861 AAGCAGAAGCTCAATGAGAGAGG + Intronic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942616089 2:177793470-177793492 AAACAGTGGCTGGATGAGGATGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943692025 2:190879597-190879619 AAGCAGGTGCTGGCTGAGGTGGG + Intergenic
943734312 2:191337217-191337239 TAGCGGAAGGTGAATGAGGAAGG - Intronic
943995179 2:194754276-194754298 GAGCATATGCTGGATGAGGTAGG + Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944175204 2:196821160-196821182 CAACAGAAGCTGGAAGAGGAAGG + Intergenic
944882520 2:204027877-204027899 AAGAAGGTGCTGGATCAGGAGGG - Intergenic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
945944874 2:215985661-215985683 AATCTGAAGCTGGTAGAGGAAGG - Intronic
946250155 2:218406614-218406636 AAGCAAAGGCTGGCTGGGGACGG - Intergenic
946521930 2:220475166-220475188 AAGCAGAAGATGGCTGATGTGGG + Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
948052502 2:234989230-234989252 AACCCGAAGCTGTAGGAGGATGG + Intronic
948075157 2:235160269-235160291 AAACAGAAGGCAGATGAGGAGGG - Intergenic
948219153 2:236255608-236255630 AAGCAGAAGATAGAGGAGAAAGG - Intronic
948287874 2:236801038-236801060 CACCAGAAGCTGGAAGAGGCGGG - Intergenic
948614071 2:239187134-239187156 ACACAGATGCTGGCTGAGGATGG - Intronic
948632036 2:239308542-239308564 AAGCAGTATCTGGCTGTGGATGG - Intronic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
948882771 2:240868921-240868943 CAGCAGGAGCTGGTTGGGGATGG - Exonic
948889475 2:240900033-240900055 AAGCAGGGGCTGGGGGAGGAAGG + Intergenic
949081138 2:242100596-242100618 AAGGAGGTGGTGGATGAGGAAGG + Intergenic
1169384484 20:5136639-5136661 AAGAACAAGATGGATTAGGAGGG - Intronic
1171320936 20:24243663-24243685 AAGCAGAAGCTGGTGGATAAAGG - Intergenic
1171544692 20:25991118-25991140 AAGCAGAAGATGGATCAAGAAGG + Intergenic
1172416728 20:34775166-34775188 AAGATAAGGCTGGATGAGGAAGG + Intronic
1172754434 20:37273301-37273323 CTGCAGTAGATGGATGAGGAAGG + Intergenic
1173134404 20:40426453-40426475 AAGCAAGAGATGGGTGAGGAGGG - Intergenic
1173187100 20:40848625-40848647 AAGCAGAGGCTGGGTGGGGTGGG + Intergenic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175522800 20:59612934-59612956 AAGCAAGAGAGGGATGAGGAAGG + Intronic
1176017937 20:62946350-62946372 ATGCAGGAGCTCGGTGAGGACGG - Exonic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177177256 21:17713627-17713649 AAGCAGAAGTTGGAAGAGTTTGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177734679 21:25073741-25073763 ATGCAGAAGCTGGAAGAGCTTGG - Intergenic
1178154605 21:29836976-29836998 AAGCAGGTGCTGGATCATGAGGG - Intronic
1178163695 21:29947900-29947922 GAGCAGGAGCTGGAGGAAGAGGG - Intergenic
1178179691 21:30145478-30145500 CAGCAGTAGCTGGATCTGGATGG + Intergenic
1178709005 21:34897751-34897773 AAGCAGAAACTGGTTGTAGAAGG + Intronic
1178918511 21:36723018-36723040 AAGCAGGAGCAAGATGAGGTTGG - Intronic
1179025064 21:37673184-37673206 GAGCAGAGGCTGGAGGAAGAGGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1180074991 21:45457668-45457690 AAGCAGAATCTGAATGGGGCAGG - Intronic
1180137629 21:45871517-45871539 AAGCAGAACCTGGCAGGGGAGGG - Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180474497 22:15690072-15690094 AAGCAGATGGTGGCTGAGGCTGG + Exonic
1180888505 22:19267010-19267032 AAACAGAATCTGGATTAGAAAGG + Intronic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181694521 22:24586189-24586211 GAGCAGGAGCTGGGTGAGGCGGG + Exonic
1181949057 22:26541251-26541273 AAGCTGCGGCTGGATGAGGCGGG - Exonic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182073092 22:27477064-27477086 AGGCAGAAGCTGGCCCAGGAGGG + Intergenic
1182357845 22:29730267-29730289 AGGCAGAAGCTCGTGGAGGATGG + Exonic
1182383915 22:29919386-29919408 AAGCAAAAGCTAGCTGAGAAAGG + Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183440171 22:37818490-37818512 AGCCAGCAGCTGGATGAGCATGG + Intergenic
1183591117 22:38779833-38779855 AAGAAGAAACTGGCTGAGGCGGG + Intronic
1183684979 22:39356566-39356588 AAACAGAGGCTGGGAGAGGAAGG + Intronic
1183733752 22:39632209-39632231 GAGAAGAGGCTGGATGAGAAGGG - Intronic
1183786880 22:40034474-40034496 GAGCAGAAGCTGCAAGGGGAAGG - Exonic
1184009460 22:41736093-41736115 CACCAGAAGCTGGAAGAGGCAGG - Intronic
1184187296 22:42873333-42873355 TATCAGAAACTGGATGAAGATGG + Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184379418 22:44135771-44135793 CACCAGAAGCTGGAGGAGGCAGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185118510 22:48951817-48951839 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
1185278285 22:49959220-49959242 AAGCAGCGGCTGGAGGGGGAGGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
950732837 3:14977165-14977187 AAGTAGAAGCTGGAGGCAGATGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
950981080 3:17305061-17305083 GAGCAGAAGCTGGATTATGGTGG - Intronic
951075337 3:18384333-18384355 AAGAAAAAGCTTGATGAGTAAGG + Intronic
951532072 3:23707157-23707179 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
952179659 3:30904451-30904473 CAGCAGAAGAGGGCTGAGGATGG - Intergenic
952331437 3:32367552-32367574 AAGCTGATGCTGTCTGAGGATGG - Intronic
952535484 3:34304870-34304892 AATCTCAAGCTGGATGAGGGTGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953385488 3:42503488-42503510 AAGCAGAAGTGGGAGGAAGAGGG - Intronic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
954035585 3:47849336-47849358 AGGCAGCACCTGGATGAGGTTGG - Exonic
954214981 3:49119673-49119695 AAATAGAAGGTGGAGGAGGAAGG + Intronic
954785194 3:53087450-53087472 ATCCAGAACCTGGAGGAGGAGGG - Intronic
955629429 3:60956723-60956745 AACCAGAAGCTGGAAGAAAAGGG + Intronic
956753338 3:72362569-72362591 AGGCAGAAAATGGATGAGGTGGG - Intergenic
957117551 3:76046076-76046098 AAGCAGGAGCTGGATAAAGATGG - Intronic
957302295 3:78407945-78407967 AACCAGAAGCGAGGTGAGGAGGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
959860763 3:111212397-111212419 AAGCAGGAGATGGATGGGTAGGG - Intronic
960270321 3:115666812-115666834 ATTCAGAAGCTGGATGACGCTGG + Intronic
960839485 3:121941877-121941899 AAGAAAAAGCTGGATCAGCAAGG - Exonic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961205885 3:125081211-125081233 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
962816057 3:139001852-139001874 TACCAGAGGCTGGAGGAGGAGGG - Intergenic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
963836892 3:150067258-150067280 AAGCAGTACCTGGATGAGAACGG - Intergenic
964057357 3:152477655-152477677 GTACAGAAGCTGGATGAGAAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964471167 3:157057313-157057335 AAGCAGAAGGTAGAGGAGGTGGG - Intergenic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
965781324 3:172289240-172289262 AAGCAGAAGCTGGGGGAATATGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968563424 4:1296647-1296669 GAGTAGTAGCTGGAGGAGGACGG - Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
969033514 4:4231840-4231862 AAGCAGAAACTGGAAGAGGCTGG - Intergenic
969211804 4:5693504-5693526 CACCAGAAGCTGGAAGAGGGAGG + Intronic
969570844 4:8007351-8007373 AAGCAGGGGCTGGGAGAGGATGG - Intronic
969598344 4:8161453-8161475 GAGCTGAGGCTGGAGGAGGAGGG - Intergenic
969660204 4:8523001-8523023 AAGCAGGAGGTGGGAGAGGATGG - Intergenic
969685705 4:8672844-8672866 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
970656514 4:18236385-18236407 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970950312 4:21747985-21748007 CACCAGAAGCTGGAAGAGGAAGG + Intronic
971235997 4:24842931-24842953 TAGCAGAAGCTGGATCTGAACGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972897886 4:43645449-43645471 AAGCAGAGGTTGGAAGAGCATGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974368968 4:60989117-60989139 AAGCAGGGCCTGGGTGAGGATGG - Intergenic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
975828498 4:78344112-78344134 AAGCAGAAGCTGGTCCTGGAGGG - Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
976559396 4:86484056-86484078 AAGCTCAAGCTGGAAGATGAGGG + Intronic
976887411 4:90002654-90002676 AAGCAATAGCTGGATGAAGGCGG + Intergenic
977173891 4:93796203-93796225 AATCAGAAGCTAGATGATGGTGG - Intergenic
977707842 4:100091473-100091495 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
979049785 4:115916221-115916243 AAGGAGGAGCTGGAGGAGGCTGG - Intergenic
979541802 4:121892075-121892097 AAGCAGGAGCTGGGAGAGGAAGG + Intronic
979552746 4:122009617-122009639 AAGCATAAGCTGGATAAAGGGGG + Intergenic
979724210 4:123941552-123941574 AAACAGAGGCTGGCTAAGGAAGG + Intergenic
980431231 4:132699133-132699155 AACGAGAAGCTGCATGAAGAGGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981057754 4:140383266-140383288 AATCACTAGCTGGATGAAGAGGG - Exonic
981124218 4:141087415-141087437 AAGGAGAGGCTGGATAAAGATGG - Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981755041 4:148133687-148133709 AACCAGAAGCTGGCGCAGGATGG + Intronic
983678457 4:170323549-170323571 AAGCTGTAGCTGTATAAGGATGG + Intergenic
984034553 4:174649258-174649280 AAACAGAAGCTGCTTGAGCAGGG + Intronic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984745118 4:183207757-183207779 GATCAGAACCTGGAAGAGGAAGG + Intronic
985090270 4:186355443-186355465 AACTAGAAGCTGGAAGAGTAAGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986775074 5:11006778-11006800 AGGCAGAAGATGGAGAAGGATGG + Intronic
986777485 5:11031119-11031141 AAACATAAAGTGGATGAGGAGGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988235237 5:28535378-28535400 TACTAGAAGCTGGAGGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989118293 5:37978002-37978024 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992331758 5:75724103-75724125 AAGCAGAAGGTTGGTGATGAGGG - Intergenic
992947780 5:81826330-81826352 AAGCAGATGCTGCCTGGGGAGGG - Intergenic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993120464 5:83768060-83768082 AATCAGAAGCTGTATGTGGAGGG - Intergenic
993644512 5:90445811-90445833 AGGAAGAAACTGGAAGAGGAGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994926804 5:106126507-106126529 AAACAGAAGCTGGGTTAGGAAGG - Intergenic
995552740 5:113296615-113296637 GAGCATAAGCTGGGTGAGAAAGG + Intronic
995613989 5:113940826-113940848 AAGCTGGGGCTGGATGAGGGAGG + Intergenic
995618142 5:113990523-113990545 TAGCAGAGGCTGGAGGAGAATGG - Intergenic
996398400 5:123035631-123035653 AAGCTGAAGCTGGAGGGGGCGGG - Intronic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997404991 5:133638566-133638588 AAGCAGGGTCTGGAAGAGGAGGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998174767 5:139894974-139894996 AGGCAGAAGCTGCACCAGGAGGG + Intronic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998814181 5:145995448-145995470 ACGTAAAAGCTGGATGAGAATGG - Intronic
999272729 5:150306960-150306982 AGGCAGAAGGTGGATGAGAGGGG - Intronic
999376603 5:151091101-151091123 AAGTAGAAGCTAGATCATGAAGG - Intronic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001146405 5:169188385-169188407 AAGAAAAACCTGGAAGAGGATGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1001865145 5:175097558-175097580 AAGCAGATGCTGGATGAATATGG + Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002401460 5:178993717-178993739 CAGCAGAATCGGGATTAGGAGGG - Intronic
1002542592 5:179915867-179915889 AGGGTGAATCTGGATGAGGAGGG - Intronic
1002978808 6:2113312-2113334 AGGAAGTTGCTGGATGAGGATGG - Intronic
1003009942 6:2417271-2417293 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1003194873 6:3905829-3905851 AACAAGAAGCTGGATGTGGCTGG + Intergenic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1003665380 6:8106855-8106877 AAGCAGATGCTGGATTGGAAGGG + Intergenic
1004336927 6:14772229-14772251 AAGCAGAAGGTGGAGGAGACTGG - Intergenic
1004431701 6:15550872-15550894 AGGAAGATGCTGCATGAGGAAGG + Intronic
1004523642 6:16385311-16385333 GAGTAGAAGATGGATGAGAAGGG + Intronic
1004697283 6:18045516-18045538 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005019480 6:21404056-21404078 CAGCAGCAGCTGGAACAGGAGGG - Intergenic
1005125372 6:22441177-22441199 AAGCATTAACTAGATGAGGAGGG + Intergenic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1006451472 6:34108072-34108094 CAGCACAGGCTGGGTGAGGAGGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007402166 6:41609007-41609029 AAGCAAGAGAAGGATGAGGAAGG - Intergenic
1008077388 6:47159328-47159350 AGGCAGAAGCTGGATCATGTGGG + Intergenic
1008375003 6:50781464-50781486 AAGTAGGAGCTGGATGGTGATGG - Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010348383 6:74840494-74840516 AGGCAGAGGCTGGAAGAGGTTGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014755465 6:125297794-125297816 AAGCAGAAGCTGGAAAATGAAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015036178 6:128657402-128657424 AAGCAGAAGTGAGAGGAGGAAGG + Intergenic
1015629727 6:135219687-135219709 AACCAGAAGCTGGAGGACAAGGG + Intergenic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017127812 6:151081934-151081956 AAGGAGAAGCTGGAGGAGATGGG - Intronic
1018000713 6:159576258-159576280 CACCAGAAACTGGAAGAGGAAGG + Intergenic
1018564304 6:165135716-165135738 AAGCAGAAGTTGGAAGAGAGTGG + Intergenic
1018660249 6:166079312-166079334 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
1019430710 7:997689-997711 ATGCGGGAGCTGGATGAGGAGGG - Exonic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1020044813 7:5032909-5032931 ATGCAGAAGTTGGAAGATGAGGG + Intronic
1020826446 7:13035232-13035254 AAGCAGAAGTTGGAAGAGTTGGG + Intergenic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021806478 7:24361884-24361906 GAAGAGAAACTGGATGAGGATGG - Intergenic
1022488125 7:30795873-30795895 AAGCAGAAGAGGGAGCAGGAAGG - Intronic
1023002513 7:35825280-35825302 AAGCAAAAGTCAGATGAGGAAGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023041193 7:36174553-36174575 AGGCAGCTGCTGGATGAGGAGGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023825523 7:44006302-44006324 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024209956 7:47194589-47194611 TACCAGAAGCTGGAAGAGCAAGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1024987478 7:55207973-55207995 AAGCAGATGATCGATGAGGCAGG + Exonic
1026089073 7:67285074-67285096 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1026113226 7:67474999-67475021 GAGCAGAGACTGGATGATGATGG + Intergenic
1026265138 7:68789721-68789743 AACCAGAAGATTGAAGAGGAAGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026725178 7:72865276-72865298 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026747313 7:73023484-73023506 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026750963 7:73051627-73051649 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026754612 7:73079737-73079759 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026758264 7:73107771-73107793 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027033416 7:74908069-74908091 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027089141 7:75285715-75285737 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027092784 7:75313643-75313665 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027096427 7:75341610-75341632 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027118661 7:75500392-75500414 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1027143641 7:75678751-75678773 AAGCAGGAGCTGGAAAAGCACGG - Intronic
1027254217 7:76420169-76420191 AAGGAGGAGGTGGAGGAGGAGGG - Intronic
1027273135 7:76535067-76535089 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027322918 7:77026077-77026099 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1027326582 7:77054147-77054169 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028686478 7:93594709-93594731 ATGCAGAACGTGGATGAGGAGGG + Intronic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1028727820 7:94109249-94109271 AAGAAGGAGGTGGAGGAGGAGGG + Intergenic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029397535 7:100318567-100318589 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029485320 7:100836548-100836570 GGGCAGCAGCTGGATGTGGAAGG - Intronic
1029712535 7:102307463-102307485 AACCAGAAGCTGGGAGAAGAGGG - Intronic
1029718826 7:102349620-102349642 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1029753789 7:102559637-102559659 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029771738 7:102658724-102658746 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1031526307 7:122825111-122825133 GTGCAGTAACTGGATGAGGAGGG + Intronic
1031766339 7:125781996-125782018 AAACAGAATCTTGAAGAGGAAGG + Intergenic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1034102057 7:148458410-148458432 TACCAGGAGCTGGAAGAGGAAGG + Intergenic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1034462770 7:151207202-151207224 AAGCAGAGGCTGCATGAGACAGG + Intergenic
1034514644 7:151565833-151565855 AAGCAGAACCTGGATGAGCTTGG - Exonic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035269863 7:157712882-157712904 TGGCAGAGGCTGGAGGAGGAGGG + Intronic
1035324058 7:158053318-158053340 AAACATGAGCTGGATGAGAAAGG + Intronic
1035539048 8:417402-417424 AAGGAGGCGGTGGATGAGGAAGG + Intronic
1036156937 8:6350875-6350897 AAGCAGAGGCCGGAGGAGGTGGG + Intergenic
1037164557 8:15810933-15810955 AGGCAGATGCTGGGTGAGTAAGG + Intergenic
1038209478 8:25502483-25502505 AAGCAGAAGATGGAAGACAAAGG - Intronic
1038243553 8:25832536-25832558 AGGCAGCAGCTGGAGGAGGTGGG - Intergenic
1038493731 8:27987503-27987525 AAGCTGAACCTGTGTGAGGATGG - Exonic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1039016498 8:33155191-33155213 AAGCAAAAGCTGGCTGGGCAAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039835944 8:41256441-41256463 AGGCTGGAGCTGGATAAGGAAGG - Intergenic
1040065687 8:43141676-43141698 AAGCAGAAGCTGGAGGAGAAAGG + Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041510222 8:58647940-58647962 AGGCAGAAGCTGGAAGAGTTTGG + Intronic
1041687116 8:60653738-60653760 AAGCGGTAACTGGATTAGGAGGG - Intergenic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1043161526 8:76853089-76853111 GAGCAGAAGGTGGAGGAGGTGGG - Exonic
1043186529 8:77158658-77158680 CACCAGAAGCTGGAAGAGGCAGG + Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043332749 8:79138132-79138154 ATGCAGAAGCTAGATCATGAAGG + Intergenic
1043369247 8:79571937-79571959 AAGAAATGGCTGGATGAGGACGG - Intergenic
1043617877 8:82149535-82149557 AAATAGAAACTGGATAAGGAAGG + Intergenic
1043724583 8:83594042-83594064 AAGCATATGATGGATGAGAAAGG - Intergenic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045079138 8:98605154-98605176 AGGCAGAGGCTGGAAGAGTATGG - Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046294984 8:112206252-112206274 TACCAGAAGCTGGGTGTGGAAGG + Intergenic
1046481338 8:114822267-114822289 GAGCAGAGGCTGGAAGAGTATGG - Intergenic
1047120885 8:121903303-121903325 AAGCAGAAGATCATTGAGGATGG + Intergenic
1047250383 8:123177813-123177835 AAGCAGAAACTGGACAAGGTTGG + Intergenic
1047353299 8:124096381-124096403 ATGCAGGATTTGGATGAGGAAGG - Intronic
1047441010 8:124878780-124878802 AACCAGATGCTGGGTGAGCAAGG + Intergenic
1048212651 8:132468229-132468251 AAGCAGAAGCTGGGATTGGAGGG + Intronic
1048300174 8:133245596-133245618 CACCAGAAGCTGGAAGAGGCAGG + Intronic
1049150962 8:141035255-141035277 AACCAGAAGCTGGAAGAGGCAGG + Intergenic
1049321438 8:141999000-141999022 CACCAGAAGCTGGAAGAGGCAGG - Intergenic
1049335269 8:142081110-142081132 AAACAGTGGGTGGATGAGGAGGG - Intergenic
1049460368 8:142724540-142724562 AAGCGGAAGATGGAAGAGGAGGG + Intergenic
1049585319 8:143430198-143430220 GCGCAGAAGCTGGGCGAGGAGGG + Exonic
1049939009 9:527020-527042 GGGCAAAAGCTGTATGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1052024219 9:23556890-23556912 AAGCTCAAGCTGGCAGAGGAGGG - Intergenic
1052183760 9:25564283-25564305 AAGGAGAAGCTGGATAAGAATGG + Intergenic
1053005352 9:34600588-34600610 GAGCAGAACTTGGATGAGGGTGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053179358 9:35954980-35955002 AAGCAGATGCTGGATGAGTGGGG + Intergenic
1053800454 9:41760726-41760748 CATCAGAAGCTGGAACAGGATGG + Intergenic
1054188884 9:61972878-61972900 CATCAGAAGCTGGAACAGGATGG + Intergenic
1054649634 9:67615739-67615761 CATCAGAAGCTGGAACAGGATGG - Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056324783 9:85467078-85467100 CACCAGAAGCTGGAAGAGGCCGG + Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056688118 9:88783536-88783558 AAGAAGAAAATGGAGGAGGAGGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057142766 9:92737585-92737607 AAACAGAAGCTGGACGATGAAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059937841 9:119329482-119329504 AAGCAGATGCTGGATGTGCCTGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1061959201 9:133979448-133979470 AGGCAGGGGCTGCATGAGGACGG + Intronic
1062357857 9:136173517-136173539 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186250647 X:7662017-7662039 GAACAGACGTTGGATGAGGAGGG + Intergenic
1187272184 X:17789230-17789252 AAATAGACGCTAGATGAGGATGG - Intergenic
1187467992 X:19543216-19543238 ATGCAGAGGGTGGAGGAGGAAGG + Intronic
1188018342 X:25129348-25129370 AAGCAGAAGTTGGATTCTGATGG + Intergenic
1188053219 X:25511890-25511912 AAGCAGCAGCTAGAAGTGGAAGG - Intergenic
1188089190 X:25941301-25941323 ATGCAGAAGGTGGATGGAGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189304197 X:39974395-39974417 AAGCAGGAGGTGGATGCTGAAGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189596319 X:42570026-42570048 AAAAAGAAGCTGGAGGAAGAGGG + Intergenic
1189723186 X:43941317-43941339 AAGCAGCAGATGGATGGGAAGGG - Intergenic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190483938 X:50905402-50905424 AAGCAGAAGGGGGATAACGAAGG + Intergenic
1190650514 X:52564135-52564157 AGGCAGCAGCTTGAGGAGGATGG - Intergenic
1191947209 X:66547872-66547894 GAGCAGAAGCTCTGTGAGGAGGG + Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192208196 X:69109966-69109988 CAGCAGGAGCTGGAAGGGGAGGG + Intergenic
1192616920 X:72634938-72634960 AAGCATAAGCTCCATGAGAACGG + Intronic
1193075023 X:77346516-77346538 TAGCAGAGGCTAGAGGAGGAGGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1193845873 X:86469187-86469209 TACCAGAGGCTGGATGATGAGGG + Intronic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1196455805 X:115890878-115890900 AAGCAGAAGCTTTTTGAGTATGG + Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196857977 X:120001176-120001198 AAGCAGGAGGAGGACGAGGAGGG - Intergenic
1196961353 X:121006194-121006216 AAGCAGAGGAGGGATGAGGGGGG - Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197862497 X:130985284-130985306 AAGCAACAACTGGAGGAGGAAGG - Intergenic
1198708425 X:139475197-139475219 AAGCAGAAGGTGGATAAGGTTGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199903070 X:152196571-152196593 GAGCAGAAGCTGTATGAGAGTGG - Intronic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic