ID: 953121525

View in Genome Browser
Species Human (GRCh38)
Location 3:40047432-40047454
Sequence TTTTATTTTAAGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1048
Summary {0: 1, 1: 0, 2: 11, 3: 83, 4: 953}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953121519_953121525 -3 Left 953121519 3:40047412-40047434 CCAGTGTACCCTTGTTCCATTTT 0: 1
1: 0
2: 3
3: 26
4: 269
Right 953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG 0: 1
1: 0
2: 11
3: 83
4: 953
953121518_953121525 17 Left 953121518 3:40047392-40047414 CCTGGAAAGACATGCAACAGCCA 0: 1
1: 0
2: 1
3: 13
4: 210
Right 953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG 0: 1
1: 0
2: 11
3: 83
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953121525 Original CRISPR TTTTATTTTAAGAAAGTGGA GGG Intronic
901657179 1:10776123-10776145 ATTTATTTCAAGGAAGTTGAAGG - Intronic
902669553 1:17963406-17963428 TTTTTTTTTAAGGTAGGGGAGGG + Intergenic
902979638 1:20113666-20113688 CTTTATCTTAGGACAGTGGAGGG + Exonic
904040114 1:27579054-27579076 TTTTTTTTTAAGACAGTGTCTGG + Intronic
904085335 1:27902746-27902768 TTTTTTTTTAAGAAATAGGCTGG - Intronic
904762546 1:32816445-32816467 TGTTATTTAAATAAAGTGGTCGG + Intronic
905236067 1:36549397-36549419 TTCTATCTTAAGAAACTGGGTGG - Intergenic
905756275 1:40512175-40512197 TTTAATCTTAAGAAACTGGGCGG - Intronic
905757310 1:40521878-40521900 TCTTATTTTAAGAAATTGCAAGG + Intergenic
905763015 1:40576300-40576322 TTTCCATTTAAGAAAGTGAAAGG + Intergenic
906251523 1:44314369-44314391 TGGTATTTTAAGGAAGTGTAAGG + Intronic
906253699 1:44331308-44331330 TTTTTTTTTAAGCAGGGGGAAGG + Intronic
906704209 1:47882804-47882826 TTTTATTTGAGGAACGAGGAAGG + Intronic
907008688 1:50942436-50942458 CTGTATTTTAAGGAAGGGGAGGG + Intronic
907062758 1:51447887-51447909 TTTTTTTTTAACAAAGTACATGG - Intronic
907680834 1:56561860-56561882 TTTTATTTTTAGTAAGGGCAGGG - Intronic
908343810 1:63210780-63210802 TTTTCTTTTAAAAGAGAGGAGGG + Intergenic
908615559 1:65917861-65917883 TTTTACTTTAAAACACTGGATGG + Intronic
908709598 1:67000296-67000318 TTTTTTTTTAAAAAAAAGGAGGG + Exonic
908727197 1:67189388-67189410 TTGGATTTTAAGAAAGAAGATGG - Intronic
908807972 1:67950231-67950253 TTTGCTTTTAAGCAAGTGGAGGG + Intergenic
909072799 1:71016859-71016881 TTTTATTTAAAGAAAGCAGATGG + Intronic
909104855 1:71394510-71394532 TTTTATTTTAAAATATGGGAAGG + Intergenic
909255229 1:73411963-73411985 TTCTATTTTAAAATAGTGCAAGG - Intergenic
909269794 1:73607956-73607978 TTTTCTTTTATTAAAGTCGAAGG - Intergenic
909324035 1:74326339-74326361 TTTTATTTTAAGGAAGTCATTGG - Intronic
909584624 1:77275700-77275722 TGTAATTTTCAGAAATTGGAAGG - Intergenic
909754851 1:79212394-79212416 TTATATTTTAACAAAGTGGATGG + Intergenic
910432386 1:87171947-87171969 TTTTTTTTTAAGAGGGTGGGTGG - Intergenic
910704223 1:90109666-90109688 TTTGCTTTTTAGAGAGTGGAGGG + Intergenic
910903887 1:92152663-92152685 TTTTTTTTTAAGCAAGTGGTAGG + Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911214955 1:95182831-95182853 TTTTTTTTTTAAGAAGTGGATGG + Intronic
911333461 1:96552556-96552578 TTTTCTTTTAAGCATGTGTATGG + Intergenic
911702460 1:100969528-100969550 TTTTCATTCAAGTAAGTGGAAGG + Intronic
911852468 1:102836718-102836740 TTTTATTTTAAGATCGTGTTAGG - Intergenic
911952464 1:104192639-104192661 TTTTTTTGTAAGAAATTTGAGGG - Intergenic
912000488 1:104828315-104828337 ATTTATTTTAAGAGAGTTAATGG - Intergenic
912013004 1:104994889-104994911 TTTTACTCTAAGAGAGTGCAGGG - Intergenic
912091066 1:106077217-106077239 TATTATTTCAAGGAAATGGATGG - Intergenic
912570845 1:110619813-110619835 TTGTATTTTTAGAATGCGGAAGG - Intronic
913451019 1:118992732-118992754 TTTTATTTTTAAAAAGTGTGAGG - Intergenic
914335197 1:146708634-146708656 TTTAATTTGAAGAAAATGTAGGG + Intergenic
914384829 1:147158450-147158472 TATTAATCTAAGAATGTGGAAGG + Exonic
915151459 1:153835416-153835438 TCTTATTTTAAGAAACTGCCAGG + Intronic
915475865 1:156152514-156152536 CTTGATTCTAAGAAACTGGAAGG + Intronic
916838324 1:168573099-168573121 TTTTATTTTAAAAAATTGACAGG + Intergenic
917368580 1:174262020-174262042 TTTTCTTTTAAGGCAGTAGAAGG + Intronic
917945885 1:179970092-179970114 TTTTATTTTAGGAGAGCTGAGGG - Intronic
918368813 1:183838115-183838137 TTTTATTTGAAAAATGTGGTCGG + Intronic
918569924 1:185977971-185977993 CTTTATTTTAAGTAGGTTGAAGG + Exonic
918583238 1:186157295-186157317 TTTTATTTCAAGATAGTAAAAGG - Intronic
918909809 1:190552742-190552764 TTTTAATTTAAAAATGTAGAAGG - Intergenic
919013445 1:191995742-191995764 TTTTAATTTAAGACAATAGAAGG - Intergenic
919712429 1:200740350-200740372 TATTATTGCAAGAAGGTGGATGG + Intronic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920018796 1:202937200-202937222 TTTTTTTAAAAGAAAATGGATGG + Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920688760 1:208129946-208129968 TTTAATTATAAGAAAGAGGTGGG - Intronic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
920824314 1:209411188-209411210 CTTTGTTTTAAAAAAGTGAAAGG + Intergenic
921493980 1:215813561-215813583 TTATATTTTAACAAAGCAGAAGG + Intronic
921823173 1:219640844-219640866 ATCTGTTTGAAGAAAGTGGAGGG + Intergenic
922111704 1:222564666-222564688 TTTTCTTTTAAAAAATAGGAAGG + Intronic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
922509102 1:226148368-226148390 GTTTATTTTAAAAAAGCAGATGG + Intronic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
923891846 1:238224610-238224632 TTTAATTTTAATAAAGTCGAGGG + Intergenic
923898643 1:238301727-238301749 TTTTATTCTAAGGAAGTGGAGGG - Intergenic
924700558 1:246447840-246447862 TTCTATTTGAAAAAAGTGGGAGG - Intronic
1062925317 10:1311876-1311898 GTGTAATTTAGGAAAGTGGAAGG + Intronic
1063350784 10:5352777-5352799 ATTTTTTTTAAAAAAGTGGGTGG + Intergenic
1063421184 10:5913641-5913663 TTTTCTTTTTAGAAATGGGAAGG + Intronic
1063743888 10:8857581-8857603 TTTTTTTTTAAAAAAATGAAGGG + Intergenic
1063926189 10:10979936-10979958 GTTTATTTTAAGAAAGTCAAGGG + Intergenic
1064246224 10:13669539-13669561 TAGTATTTTAAGAAAGTGATTGG - Intronic
1064678488 10:17785579-17785601 TTTTTTTTTAATAAAATGAATGG + Intronic
1064684971 10:17851200-17851222 AATTATTTTAGGAAATTGGATGG + Intronic
1064806929 10:19145738-19145760 TTTTTTTTTGAGAAAGTGTTAGG + Intronic
1064959507 10:20948005-20948027 TAATGTTTTAAGAAAGTTGATGG + Intronic
1065060772 10:21898824-21898846 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1065098602 10:22309583-22309605 CTATATTTTATGAAAGGGGATGG - Intergenic
1065213131 10:23423812-23423834 ATATATTTTGGGAAAGTGGAGGG - Intergenic
1065255646 10:23864756-23864778 ATTTATTTTAAGAAATTGACTGG + Intronic
1065672948 10:28141964-28141986 TTTTTTTTTATTCAAGTGGATGG - Intronic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1065843339 10:29724608-29724630 ATTCATTTTTAGGAAGTGGATGG + Intronic
1066108154 10:32173655-32173677 TTTTCTTTTAAGAAAAAGAAAGG - Intergenic
1066165127 10:32779063-32779085 TTTGATTTAAACAAAGTGGTCGG + Intronic
1066377535 10:34870976-34870998 CTTTATTTTTAGAAATTGGCAGG + Intergenic
1066438755 10:35417538-35417560 CTTTGTTTTAATAAAGGGGAAGG + Intronic
1066667048 10:37793360-37793382 TTTTATTTCAATAAAGCAGATGG + Intronic
1066752870 10:38677118-38677140 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
1067309719 10:45101527-45101549 TTTTAGTCTAAGCAACTGGAAGG - Intergenic
1067795798 10:49320735-49320757 ATTTATTTTAAGGAACTGGCTGG + Intronic
1068368370 10:56082197-56082219 TTATATTTTAAGAAAGTCTTAGG + Intergenic
1068372943 10:56142399-56142421 TTTTTTTTTGAGGAAGTGGTAGG + Intergenic
1068582510 10:58758057-58758079 TTTTTTTTTAAGATAGTAGAAGG - Intronic
1069472867 10:68708436-68708458 TTTTTTTTAGAGACAGTGGAGGG + Intergenic
1069999150 10:72363369-72363391 TGTTTATTTAAAAAAGTGGACGG - Intergenic
1070050132 10:72880825-72880847 TTTGATTTTAAGAAGATGGCAGG + Intronic
1070066879 10:73044184-73044206 TTTTGTTTAAAAAAAGTGAAAGG - Intronic
1070185005 10:74053339-74053361 TTTTATGCTAATAAATTGGAAGG - Intronic
1070493095 10:76995702-76995724 TTTTATTTCAGGACAGTGGCCGG - Intronic
1071063604 10:81603879-81603901 TTTTATTTTTTGCAAATGGAAGG - Intergenic
1071159631 10:82730387-82730409 TTAAATTTTAAGAAAATGTAGGG - Intronic
1072329541 10:94333734-94333756 TTTTATTTCAATACTGTGGATGG - Exonic
1072556225 10:96515787-96515809 TTTTATGTTATTAAAGTAGAAGG + Intergenic
1072962203 10:99939606-99939628 GTTTAGTTTTAGAAAGTGGAAGG - Intronic
1073236280 10:102019385-102019407 TTTTTTTTTAAATAAGTAGAAGG - Intronic
1073360280 10:102893247-102893269 TTTTATATTAAGAAATTTTAAGG + Intronic
1073613143 10:104964700-104964722 TTTTACTTTAAAAAATTGTAGGG + Intronic
1073770906 10:106734813-106734835 TTTTATTTCAAGAAATGGGTGGG + Intronic
1073948534 10:108780756-108780778 TTATTTTTTAAAAAAGTGCATGG - Intergenic
1073974672 10:109087179-109087201 TTTTTTTTTAAGTAAGTTGCAGG + Intergenic
1074026359 10:109640079-109640101 TTTTATTTTTATTAAGGGGAAGG + Intergenic
1074280723 10:112049025-112049047 TCTTAATTTAAGGAAGAGGAGGG - Intergenic
1074342768 10:112650462-112650484 TTTTTTTTTAAATAAGTGGAAGG + Intronic
1074647747 10:115481290-115481312 TTTTGTTTTAAAAAAGAGCAAGG + Intronic
1074949368 10:118314605-118314627 TTTCTTTTTATGGAAGTGGAAGG - Intronic
1075225269 10:120623421-120623443 TATTATTTTAAGAAATTGACAGG + Intergenic
1075659865 10:124185782-124185804 TTTCATTTTAAGAGAGTTTATGG - Intergenic
1076407131 10:130220097-130220119 TTTTCTTTTAAGAGATTGAAAGG + Intergenic
1076481435 10:130787706-130787728 TTTTATTCTAAGGCTGTGGATGG + Intergenic
1078028577 11:7724283-7724305 CATGATTTTAAGAAACTGGAAGG + Intergenic
1078292626 11:10028213-10028235 TTAGACTTTTAGAAAGTGGATGG - Intronic
1078415153 11:11158672-11158694 ATTTAGGTTAAGAAAGTTGATGG + Intergenic
1079605939 11:22366693-22366715 TTATATTTTAAAAAGGTGGCTGG + Intronic
1079694889 11:23469235-23469257 ATTTATTCTCAGTAAGTGGATGG + Intergenic
1079774928 11:24513113-24513135 TATTATTTTAAGAAAATAGATGG + Intronic
1080191131 11:29550541-29550563 TTTTTTTTTAATATAGTGGCAGG - Intergenic
1080555188 11:33409703-33409725 TTTTAAATTGAGAAAGGGGATGG - Intergenic
1080566461 11:33513903-33513925 TTTAATTTTCAGACAGTAGAGGG - Intergenic
1080738584 11:35042101-35042123 ATTTAATTGAAGAAAGGGGAGGG - Intergenic
1080926992 11:36767920-36767942 TCTTATTTTAAGAAAGACTAGGG - Intergenic
1081197321 11:40177332-40177354 TTTTACCTTAAGTAAGTGGTGGG - Intronic
1081761421 11:45578870-45578892 TTTTATTTTAATTATGTTGATGG + Intergenic
1083240196 11:61382198-61382220 TTTTATTTTTAGAGATTGGGGGG - Intergenic
1084689568 11:70717075-70717097 TGTTGTTTTAACCAAGTGGACGG - Intronic
1085378594 11:76091287-76091309 TTTTATTTTTAGAAATTTGTAGG + Intronic
1085934886 11:81129079-81129101 TTATATTTTAAGTAAGTTGCAGG - Intergenic
1086007893 11:82061752-82061774 TTATATTGTTAAAAAGTGGAAGG - Intergenic
1086019529 11:82209980-82210002 TGTTTTTTTAAGATAGTGGTTGG - Intergenic
1086080087 11:82895037-82895059 ATTGATTTTAAAAAAGTGAAGGG + Intronic
1086086637 11:82962034-82962056 TTTTATTTTAAGACAGGGTCTGG + Intronic
1086238768 11:84663664-84663686 ATTTATTTTTTGAAAGTGAAAGG - Intronic
1086402045 11:86469049-86469071 TTTTTTTTTAAGAACCTGTAAGG - Intronic
1086428453 11:86711640-86711662 TGGTTTTTTAAAAAAGTGGAGGG + Intergenic
1086781553 11:90912427-90912449 TTCTATTTTAAGAAGGAGGTGGG + Intergenic
1087012571 11:93527819-93527841 TTTGCTTTTAAGAAACAGGATGG + Intronic
1087148964 11:94841133-94841155 TTTTATGTTAAGAAAAGAGAAGG + Intronic
1087477800 11:98659304-98659326 ATTTATTTTTAGAAAGTGAGAGG + Intergenic
1087520289 11:99224873-99224895 ATTTATTTTGAAAAACTGGAAGG + Intronic
1087539780 11:99501853-99501875 TTTGATTTTAAAAATGTGGAAGG + Intronic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1087840206 11:102912567-102912589 TTTTCTTTCATGACAGTGGATGG + Intergenic
1088246010 11:107818972-107818994 CTCTATTTTAAAAAAGTGGGGGG + Intronic
1088343983 11:108801956-108801978 ATTTTTTTTAAAAAAGTGGGGGG + Intronic
1089447764 11:118567065-118567087 TTTATTTTTAATAGAGTGGAGGG - Intronic
1089743381 11:120600336-120600358 TTTTTTTTTAAGACAGAGGGGGG - Intronic
1090185775 11:124738402-124738424 TTTTTTTTTACAAAAGTGGGTGG + Intergenic
1090242111 11:125191490-125191512 TTTCACTCTAAGAAAGTGGTGGG + Intronic
1090369873 11:126242079-126242101 TTTAATTTTTATAAAGTGTATGG - Intronic
1090374148 11:126277201-126277223 TTTTATTTTTGGACATTGGATGG + Intronic
1090526864 11:127546647-127546669 TTTCCTCTTAAAAAAGTGGATGG - Intergenic
1090545601 11:127763899-127763921 TTTTATTTTAGAAATGTGAAAGG - Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1091096336 11:132825766-132825788 TGTTAGTTTAACAAAGTGAAGGG + Intronic
1091634456 12:2186497-2186519 TTTTATTTTAAAGAAATGAAGGG + Intronic
1091987600 12:4924930-4924952 TTTTAATTTAACGAAGTAGAAGG - Intronic
1092734762 12:11570139-11570161 TTTTATTTTTAGATATTGGTAGG + Intergenic
1093044418 12:14426409-14426431 TTTTCTTTGAAGAAATTAGATGG - Intronic
1093135527 12:15445468-15445490 ATTTATTGTAAGAAAATGAAAGG + Intronic
1093225487 12:16478632-16478654 TTTTAATTTCAGAAAGTGGGAGG + Intronic
1093709767 12:22317292-22317314 TTTTATTTAATAAATGTGGATGG + Intronic
1093830158 12:23746245-23746267 CTTGACTTTAAAAAAGTGGAAGG + Intronic
1094186185 12:27645439-27645461 TTTTTTTTTAAAAAAGTGTGGGG + Intronic
1094262302 12:28515005-28515027 TCTTTTTTTAAAAAAGTTGAGGG - Intronic
1094320542 12:29178296-29178318 TTTTGTTTTAAGAAAAAGGAGGG + Intronic
1094725346 12:33108454-33108476 ATTTACTTTAAGAATGTTGAGGG - Intergenic
1095251823 12:39988464-39988486 TTATATTTAAAAAAAGAGGAAGG + Intronic
1095321035 12:40827346-40827368 TTTCATTTCAAAAATGTGGAAGG - Intronic
1095680989 12:44975416-44975438 TTTTATTTTAATAAATTTTAAGG - Intergenic
1095812707 12:46387445-46387467 TATTTTTTTAAGCAAGTTGATGG + Intergenic
1095894779 12:47269123-47269145 TGTTATTTTAAGTAGGTGCATGG - Intergenic
1096000432 12:48125313-48125335 TTTTTTTTTAAGAGATGGGACGG + Intronic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1096302242 12:50440427-50440449 TTTTCTTTTTAGGAAGTGAAAGG + Exonic
1096598482 12:52713451-52713473 TTTTATTTGAAAAAAGTCGTAGG - Intergenic
1098024012 12:66183976-66183998 TTTTAGTTCAAGCAACTGGAAGG + Intergenic
1098074401 12:66713176-66713198 TTCTACTTTGAGAAAGTAGAAGG - Intronic
1098448876 12:70596506-70596528 TTTTTTTTTAAGAAAGTGAAAGG - Intronic
1098510326 12:71305572-71305594 TTATAATTTAATAAAGTAGAAGG - Intronic
1098558112 12:71841928-71841950 TTTTTCTTTAGGAAAGGGGATGG + Intronic
1098632634 12:72742384-72742406 TTTTCTTTTAAGAATGCTGAAGG - Intergenic
1098647775 12:72926135-72926157 TATTGTTTTAAAAAAGTGGAGGG - Intergenic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1098786280 12:74760586-74760608 TATTATTTTAAAAAAATTGAAGG - Intergenic
1099294361 12:80811673-80811695 TTGTATTTTCAGAGTGTGGAAGG - Exonic
1099372739 12:81857599-81857621 TCATATTTTAGGAAAGAGGATGG + Intergenic
1099593046 12:84620986-84621008 TTTTTTTTTAAGAGACAGGATGG + Intergenic
1099623167 12:85030423-85030445 TATTATTCTGAGAAAGGGGAAGG - Intronic
1100163444 12:91889204-91889226 TTTTATTTTAAAAAAATGTCAGG + Intergenic
1100459254 12:94782644-94782666 TTTTATTTTGAAAATGTGAAAGG + Intergenic
1100500874 12:95172947-95172969 TTTAATGTTAAGAAGGTGGGTGG + Intronic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100969300 12:100050484-100050506 TTTTTTTTTAAGTAAATGAAAGG - Intronic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1101177577 12:102171153-102171175 TTTTTTTTTAAATAAGTAGAAGG + Intronic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101395145 12:104340669-104340691 TTTCTTTATAAGAAAGAGGAGGG - Intronic
1101761366 12:107661480-107661502 TTTTTTTTTTTGAAAGAGGAAGG - Intergenic
1102324084 12:111963947-111963969 ATTTCTTTTATGAAAGTAGATGG + Intronic
1103549048 12:121723172-121723194 TTTTGTTTTAAGAGAGAGGGGGG + Intronic
1103577617 12:121890087-121890109 TTTTATTTTAAGTAAAAGCAGGG + Intronic
1103821970 12:123706055-123706077 ATCTATTTTGAGAAAGAGGAGGG - Intronic
1104204380 12:126623108-126623130 TTTTTTTTTAAATAAGTGGAAGG + Intergenic
1104384103 12:128334552-128334574 TTTTATTTCAAGAAACTAGTGGG - Intronic
1104479832 12:129097906-129097928 TTTAATTTTAATAAAGTCCAGGG + Intronic
1105466446 13:20646305-20646327 TTTTTTTTTGAGACAGAGGACGG + Intronic
1105758445 13:23491420-23491442 TTTTATTTAATGAAACTTGATGG + Intergenic
1106004097 13:25752469-25752491 ATTTATCTTAAGAAAGTAAATGG + Intronic
1106172325 13:27298582-27298604 TTCCTTTTTAATAAAGTGGAAGG + Intergenic
1106203494 13:27565945-27565967 TTTTCTTTTAATAAAGGAGATGG + Intronic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1106362417 13:29044690-29044712 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1106392612 13:29350126-29350148 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1106577202 13:30986472-30986494 TTTTAGGTTAAGAAACTAGAGGG - Intergenic
1106607267 13:31240765-31240787 TTTTATTTTTAGAAATTGATAGG + Intronic
1106986020 13:35351566-35351588 TTACATTTTAAGAATATGGAGGG + Intronic
1107148852 13:37089295-37089317 TTTTAGTTTTATAAATTGGAGGG + Intergenic
1107449430 13:40495254-40495276 TTTTGTTTTAAGATAATGGTAGG + Intergenic
1107870359 13:44740846-44740868 TTTTATTTTTACAAAAAGGAAGG - Intergenic
1108360664 13:49665722-49665744 TTTTTTTTTAAGCATTTGGAAGG + Intronic
1108575975 13:51791315-51791337 TTTAATTTTAAAAAAGTATACGG + Intronic
1108617864 13:52152438-52152460 TTATATTTTAAGAAAGGTGGGGG + Intronic
1108706420 13:52992495-52992517 TTTTTTTTTAATGAAGTTGATGG - Intergenic
1108923029 13:55700215-55700237 TTTTATTTTAAGACACCAGATGG - Intergenic
1109006103 13:56879800-56879822 TTTTTTTTTAATAATTTGGATGG - Intergenic
1109210759 13:59533171-59533193 TTTTATTGGAAGGAGGTGGATGG - Intergenic
1109310047 13:60683026-60683048 TTTTTTTTTAAGTGAGAGGAAGG - Intergenic
1109698093 13:65987751-65987773 TTTTATTTTAATAAAATAAATGG - Intergenic
1110158301 13:72344532-72344554 TTTTCTTTTAACAAAGTGTTAGG - Intergenic
1110232356 13:73180290-73180312 TTTTTTTTTAAAAAAGTAGAAGG - Intergenic
1110309218 13:74027804-74027826 TTTTATGTGAAGAATGTGTATGG - Intronic
1110419115 13:75285150-75285172 TTGTCTTTTAAGAAACTGTATGG + Exonic
1110578771 13:77093611-77093633 TTTTAGCTTAAGCAACTGGATGG - Intronic
1110667687 13:78137350-78137372 TTTTTTTTTAAGAAAAAGAAAGG - Intergenic
1110883017 13:80596495-80596517 TTTTTTTTTAAGAAATTGTAAGG - Intergenic
1111224448 13:85251653-85251675 TGTTACTTTAAGAAAGCAGAGGG + Intergenic
1111254052 13:85642328-85642350 TTTTTTTTTAAGCAAGTGAGTGG + Intergenic
1111307035 13:86428044-86428066 TTTCTTTTTAATAAAGTGTAAGG + Intergenic
1111382460 13:87477021-87477043 TATTATTTTCTGAAAGTTGAAGG + Intergenic
1111530621 13:89532744-89532766 TCTTATTTTAAGAAATTGCCAGG - Intergenic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1111944096 13:94645505-94645527 TTTTTTTTTAAGTAAATGAAGGG + Intergenic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112303885 13:98255728-98255750 TGTTTTATTAAGAAAGTTGAAGG - Intronic
1112360739 13:98715807-98715829 TTTAATTTAAAGAAAGTAGAAGG + Intronic
1112930100 13:104724224-104724246 TTTTATTTTAAGAAGCTATATGG - Intergenic
1112964499 13:105170968-105170990 ACTTATTTTAAGAAAGTTCAGGG - Intergenic
1113075197 13:106461216-106461238 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113394756 13:109936802-109936824 ATTTATTTTAAGGAATTGGCTGG - Intergenic
1113466312 13:110515732-110515754 TTTCTTTTTAAATAAGTGGATGG - Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1113837978 13:113341822-113341844 TTTTATTTTTAGAGATGGGAGGG + Intronic
1114253268 14:20979922-20979944 TTTAATTTTGAGGCAGTGGAGGG + Intergenic
1115037532 14:28877002-28877024 ATTTATTTTAAGAAATTAAATGG + Intergenic
1115064290 14:29237950-29237972 ATTTATTATAAGAAAGTGCTTGG + Intergenic
1115518532 14:34209563-34209585 TTTGCATTTAAGAAAGTGAAGGG - Intronic
1116194617 14:41707183-41707205 TTTTATCTTACTAAGGTGGAAGG + Intronic
1116250534 14:42476281-42476303 TTTTATTTTTACATAGTGGTTGG + Intergenic
1116629259 14:47308426-47308448 TTATTTTTTAAGAATGTGGAAGG - Intronic
1116680603 14:47964880-47964902 ATTTATTTTCAGAACTTGGAAGG + Intergenic
1116765178 14:49061724-49061746 TATTTTTTTAAGAGATTGGATGG - Intergenic
1117350483 14:54876717-54876739 TTTTGTGTAATGAAAGTGGAAGG + Intronic
1117363463 14:55001080-55001102 TTTTTTTTCAAGAATTTGGAGGG + Intronic
1117542303 14:56760145-56760167 CTTTTATTTAAGAAAGTGGCTGG - Intergenic
1117923765 14:60754248-60754270 TTTTGTTTTAATAAAGATGAAGG - Intronic
1118007110 14:61573330-61573352 TTTTATTTTGGAACAGTGGAAGG + Intronic
1118237133 14:64017507-64017529 TTTTATTTTAAAACAGTGTTTGG + Intronic
1118280067 14:64420232-64420254 CTTTATTTTAGCAAAGTTGATGG + Intronic
1118340122 14:64888441-64888463 TTTTTTTTTAAGATAGTAGCAGG + Intergenic
1118756184 14:68845657-68845679 TTTTCTTTTAAGACAGTGTCAGG + Intergenic
1118885181 14:69860124-69860146 TTAGATTTTAAAAAAGTAGAAGG + Intronic
1118894363 14:69933252-69933274 ATTTATTTTCAGAAACAGGATGG + Intronic
1119828170 14:77675548-77675570 TTTAACTTTAAAAAAGTGGTTGG - Intronic
1119941836 14:78649442-78649464 TTTTTTTTTAAGAAAAAGAAAGG - Intronic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120094520 14:80373870-80373892 TTTTAGCTGAAGTAAGTGGAAGG + Intronic
1120742359 14:88122129-88122151 TTTTTTTTTAGGTAAGTGAAAGG - Intergenic
1120809436 14:88788523-88788545 TTTTTTTTTAACATAGTGAAAGG - Intronic
1120825879 14:88954742-88954764 TTTTCATTAAAGAAAATGGATGG - Intergenic
1121287175 14:92745352-92745374 TTTTACTTCAAGAAATTGAAGGG + Intronic
1121533020 14:94671815-94671837 TTTGTTTTGAAGAAAGGGGAGGG + Intergenic
1122216642 14:100208874-100208896 TTATTTTTTAAGGAAATGGATGG + Intergenic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1122296277 14:100708172-100708194 TGTTATTTAAAGAAAATGTAGGG - Intergenic
1122386826 14:101354481-101354503 TTTTATTTTTAGAAAATGCATGG + Intergenic
1122827708 14:104378943-104378965 TGATATTTTAAGAAATTGGCAGG + Intergenic
1124917174 15:33987347-33987369 TTTTATTTAACAAAAGGGGAAGG + Intronic
1125098049 15:35877255-35877277 CTTTATTTTATGAAAATGAAAGG - Intergenic
1125178264 15:36850932-36850954 TTTAATTTTAAAAAATTGAAAGG + Intergenic
1125493227 15:40164672-40164694 TTTTTTTTAAAGAAAGAGGCAGG + Intronic
1125691093 15:41596808-41596830 TTTTTTTTTAATAAAGATGAGGG + Intergenic
1125870491 15:43096460-43096482 TCTTATTTTAAGAAATTGCCTGG - Intronic
1125982525 15:44015871-44015893 TATTATTTTAAGTAAATGAAAGG + Intronic
1126466832 15:48968451-48968473 TTTAAATTTAATAAAGTAGAAGG - Intergenic
1126959662 15:53977535-53977557 TTTGCTTTTTAGAAAATGGAAGG - Intergenic
1127107502 15:55632482-55632504 TTTTATTCTAAGAGAGAGGAAGG - Intronic
1127178647 15:56390085-56390107 TTTTTTTTTAATAAAAGGGATGG + Intronic
1127210041 15:56764697-56764719 TTTAGTTGGAAGAAAGTGGAGGG + Intronic
1127228483 15:56961408-56961430 TTTTATTTTAATAATATGGTTGG - Intronic
1127289376 15:57556752-57556774 TTTTGTTTTAAAAAACTGCAGGG - Intergenic
1127812474 15:62576615-62576637 TTGCATTTTAAGAGACTGGAGGG + Intronic
1127923362 15:63512741-63512763 TTGTATCTTAAGAAAGGGGGAGG - Intronic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1129415651 15:75376846-75376868 TTTTTTTTTAAGACAGTGTCTGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130574926 15:85083313-85083335 TTTTTTTTTAAAAAAATGAAAGG + Intronic
1130824256 15:87527663-87527685 TTTTATTCTCAGAAGGTTGATGG - Intergenic
1131435777 15:92420332-92420354 TTTCATTATGAGAAAGAGGAAGG + Intronic
1131624083 15:94099634-94099656 TCTTATTTTAAGCCAGTGGTGGG - Intergenic
1131959120 15:97769892-97769914 TTTTATTTAAAAAATGTGGCCGG + Intergenic
1133177797 16:4028664-4028686 TTTTATTTTTAGAAAATTTAGGG - Intronic
1133576905 16:7100293-7100315 TTTTATTTTCAGAAAGAGTCAGG - Intronic
1133856970 16:9558850-9558872 GTTTATTATATGAAAGTGCACGG - Intergenic
1134474006 16:14555221-14555243 TTTTATTTAAAAAACGTGGAAGG - Intronic
1135854701 16:25997086-25997108 TTTTATTTTGACAAAGTGTCTGG - Intronic
1136018202 16:27419732-27419754 TTTTTTTTTAAGTAAGTACAAGG + Intronic
1136608323 16:31351543-31351565 TTGTATTTTAAGAAAATGTGGGG + Intergenic
1136729832 16:32399890-32399912 TTTTTTTTTAAGAATGCTGAAGG + Intergenic
1137019233 16:35407101-35407123 TTTTATTTTGAGATTGGGGATGG - Intergenic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1137715617 16:50596603-50596625 TTTTCTTTCAAGAAAATGCAGGG + Intronic
1138545559 16:57717388-57717410 TTTTTTTTTAAGCCAGTGCATGG - Intronic
1139201502 16:64982015-64982037 ATTTATTTTAAGAGCTTGGATGG - Intronic
1139224645 16:65222385-65222407 TTTTATTTTAAAAATGTGCTGGG - Intergenic
1139998427 16:71002606-71002628 TTTAATTTGAAGAAAATGTAGGG - Intronic
1140500288 16:75428138-75428160 TTTTTTTTTAAGAGGGTTGACGG + Intronic
1140586042 16:76292980-76293002 TTTTCTTTTTTGAAAGTGGCTGG - Intronic
1141306935 16:82873688-82873710 TTTTATTTTAAAAAGTTGGTTGG + Intronic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1141889824 16:86919153-86919175 TTTTATTTTATTAAAGGGGCAGG - Intergenic
1202996567 16_KI270728v1_random:117425-117447 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
1203023254 16_KI270728v1_random:429767-429789 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143473311 17:7189909-7189931 TTTTCTTTTGAGAGAGTGAAAGG - Exonic
1143611915 17:8022819-8022841 TGTTTTTTCAAGAAAGTGGAAGG + Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144292970 17:13844138-13844160 TTTTTTTTTAACAATGTGGGAGG + Intergenic
1144333082 17:14241960-14241982 TTTTATTTATATAAAGTGCAAGG - Intergenic
1144402985 17:14924809-14924831 TTTTATTTTAAGAGACACGAAGG + Intergenic
1144592852 17:16539510-16539532 TTTGAATTTAAGAAACTGTATGG + Intergenic
1145166454 17:20616303-20616325 ATTTATTGTAAGAAAGTTTAAGG + Intergenic
1145947831 17:28791215-28791237 TTTTATTTTAAAAAAATACAAGG + Intronic
1146542499 17:33709672-33709694 TTTTATTTTAAGAAATTGTTTGG - Intronic
1146556595 17:33830344-33830366 TTTTATTTTGACAAAAAGGAGGG - Intronic
1146595426 17:34164197-34164219 TTTTATTTTATGAAAGAGCTAGG - Intronic
1146925878 17:36744728-36744750 TTTTTTTTTAGTAAGGTGGAAGG - Intergenic
1147273359 17:39293517-39293539 TTTTATTTTAAGAATCAGGCCGG - Intronic
1147396181 17:40144672-40144694 TTTTTTTTTAAAAAAGAGGCAGG + Intronic
1148068908 17:44894874-44894896 TTTAGTATTAAAAAAGTGGAGGG - Intronic
1148555178 17:48574524-48574546 TTTTATTTTCTGAAAGGAGATGG + Intronic
1148575641 17:48709052-48709074 TTTTTTTTTAAGAAATGGGGAGG - Intergenic
1148659687 17:49319332-49319354 TTTTTTTTTAAGACAGTGTCGGG + Intronic
1149005153 17:51797545-51797567 TTTCTTTTTAAGGGAGTGGAGGG - Intronic
1149056153 17:52368719-52368741 TTTTTTTTTTACAAATTGGAAGG + Intergenic
1149132708 17:53324982-53325004 ATTTATTTCAAGAAAGTCTATGG - Intergenic
1149192189 17:54076668-54076690 TCTTATTTTAAGAAAATGCCAGG + Intergenic
1149206681 17:54255572-54255594 ATATAATTTAAGAAAGTGAATGG - Intergenic
1149332894 17:55604902-55604924 TTTTATTCTAAGAAAGCTAAGGG - Intergenic
1149439002 17:56659483-56659505 GGTTATTCTAGGAAAGTGGAAGG - Intergenic
1149660137 17:58330555-58330577 TTTTAATCTAAGAAAGTCTAGGG - Intergenic
1149874649 17:60219580-60219602 TTTTTTTTTAAGGAAATGCATGG + Intronic
1150088438 17:62296819-62296841 TTTTTTTTTAAGGAAATGCATGG + Intergenic
1150472306 17:65447464-65447486 TGTCATTTTAAGAGAGTGAAAGG + Intergenic
1150501178 17:65652213-65652235 TTTTGATTTAATAAAGTGTAGGG + Intronic
1150856730 17:68760276-68760298 ATTTATTTTAAGGAATTGGCTGG + Intergenic
1151111541 17:71683745-71683767 ATTTATGTTGAGAAAGAGGAGGG - Intergenic
1151119972 17:71782150-71782172 TCATATTTTAAGAAATTGCAGGG + Intergenic
1152771506 17:82172414-82172436 TTTTATATTTGTAAAGTGGAAGG - Intronic
1153053239 18:920248-920270 TTGTTTTCTAAGAAAATGGAGGG + Intergenic
1153338905 18:3954139-3954161 TTTTATTTTAATAAAGGAAATGG + Intronic
1153554827 18:6300994-6301016 TTTTATTTTAAACAAATGGGTGG - Intronic
1153568218 18:6442087-6442109 TTTTTTTTTAACACAGTCGATGG - Intergenic
1153672257 18:7423044-7423066 TTTTATTTTCAGAAATTTTATGG - Intergenic
1153978274 18:10288190-10288212 TTTTCTTTTCAGAAAGTCAAAGG + Intergenic
1154079090 18:11236656-11236678 TTTTATTATAAGAAGTTGTATGG - Intergenic
1154928371 18:20964118-20964140 TTTTTTTTTAAGTAGTTGGATGG - Intronic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1156235072 18:35195163-35195185 TTTTATTTTAACAAAGTGTATGG - Intergenic
1156531965 18:37825966-37825988 TTTTATCTAAAGAAAATAGAAGG + Intergenic
1156562533 18:38143862-38143884 TTTTATTTGAAGAATTTAGATGG + Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1157136585 18:45062907-45062929 TTTTATTTTAATAAAGAAAAAGG + Intronic
1157539715 18:48491884-48491906 TTTGGTGGTAAGAAAGTGGATGG + Intergenic
1157848104 18:51022654-51022676 TCTTATTTTAAAAAAAAGGACGG - Intronic
1158004372 18:52655129-52655151 TTTTTTTTTAAGAGAGAAGAGGG + Intronic
1158364181 18:56712505-56712527 TTTTATTTTATGAAAAAGCAAGG - Intronic
1158715890 18:59879497-59879519 TTTTTATTTAAGAAAGTGAGTGG - Intergenic
1159056136 18:63465761-63465783 TTTTTTTTTTAGACAATGGAAGG + Intergenic
1159085648 18:63788119-63788141 TTTTATTTTTCGTAAGTAGAAGG - Intronic
1159094749 18:63890197-63890219 TTTTTTTTTAAGAAAGTGATTGG - Intronic
1159332179 18:67010265-67010287 TTACATTTTTAGAAACTGGAAGG - Intergenic
1159636336 18:70809477-70809499 TTTAACTTTAAGAAAATGAAAGG + Intergenic
1159666535 18:71168239-71168261 TTTAATTTTAAAAATGAGGATGG + Intergenic
1159732160 18:72041656-72041678 TTTTCTTTTAAGAAAAGAGAGGG + Intergenic
1159904832 18:74080149-74080171 ATTTATTTTAAGAAATTGCTTGG - Intronic
1160050366 18:75427700-75427722 TATTATTTTATGAAGCTGGATGG + Exonic
1160523021 18:79519735-79519757 TTTTATTCTCAGAACGTTGAAGG + Intronic
1161264093 19:3355555-3355577 TTTTTTTTTAAGAAATGGGGGGG + Intergenic
1161341243 19:3743843-3743865 GTTTACTATAAGGAAGTGGAGGG + Intronic
1161530865 19:4788425-4788447 ATTTATTTTAAAAAATTAGAGGG - Intergenic
1161603395 19:5199627-5199649 TTTTTTTTTAAAAAAAAGGAGGG - Intronic
1161654381 19:5504901-5504923 TTTTAATTTATGAATTTGGATGG - Intergenic
1162047831 19:8012842-8012864 TTTTTTTTTAATACTGTGGAAGG + Intronic
1162829762 19:13277010-13277032 TTTTTTTTTAAGCAAGTGCAGGG - Intronic
1163380073 19:16960198-16960220 TTTTTTTTTGAGAAAGGAGAAGG - Intronic
1163653167 19:18530628-18530650 TTTTTTTTTAATAAAGAGGTGGG - Intergenic
1163813537 19:19449494-19449516 TTTTATTTTTAAAACGTTGATGG + Intronic
1163956801 19:20650233-20650255 TTTTTTTTTAACAAATTTGATGG - Intronic
1164407017 19:27958751-27958773 TTAAATTTTAAGAATGTGGTTGG + Intergenic
1164503970 19:28842922-28842944 TTTTCTTCTAAGAAAGAGGCTGG + Intergenic
1165208687 19:34214607-34214629 TTCTATTATAAGAAAGTAAAGGG - Intronic
1165604719 19:37091987-37092009 TTTTATTGTAAAATAGTTGAGGG + Intronic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
1167287339 19:48605845-48605867 TTTTATTTTAAAAAATTGGCCGG - Intronic
1167827504 19:51987163-51987185 TTTAAATTTAACAAAGTGGATGG - Intergenic
1168522914 19:57066848-57066870 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG + Intronic
925001730 2:408465-408487 TTTTTTTTTAAGTCAGAGGAGGG - Intergenic
926450198 2:12994273-12994295 ATTTGTTTTAAGAAACTGGATGG - Intergenic
926664292 2:15503233-15503255 TTTTTTTTTTAGTAAGTAGAAGG + Intronic
926955761 2:18297562-18297584 TTTTATTTTATGAAATGGAAAGG - Intronic
927007694 2:18867052-18867074 TTTGATTTTATGTAGGTGGAAGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
927967940 2:27283362-27283384 TTGTATTTAAGGAAAGTTGAAGG + Intronic
928015029 2:27648216-27648238 TTTTGTTTTAAGAATATGTAAGG + Intronic
928044824 2:27919159-27919181 TTTTATTTTCTGACAGTTGATGG + Intronic
928048387 2:27962603-27962625 TTTTATTTTATGAAACAGAAGGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928737604 2:34310357-34310379 TTTTAATTTAAGAACATGGGTGG - Intergenic
928783548 2:34854164-34854186 TTCTACTTTAAGAAAGGAGAGGG + Intergenic
928787057 2:34900848-34900870 TTGTGGTGTAAGAAAGTGGAAGG - Intergenic
929005027 2:37385742-37385764 TTATGTTTTAAGAAAGTTTATGG + Intergenic
929292601 2:40210485-40210507 TTTGATTTCAAGAAATTGAAGGG + Intronic
929548749 2:42875549-42875571 TTTTTTTTTAAATAAGTGTAAGG + Intergenic
929552109 2:42900925-42900947 TTTGATTTTAAGGAAGAGAAAGG - Intergenic
929703645 2:44188151-44188173 TTTGTTTTTAAGAAGGGGGATGG + Intronic
929707236 2:44226705-44226727 TTTTTTTTTAATAAAATGGTAGG + Intronic
930194769 2:48498010-48498032 TTATATTTTAATTAAGTGGATGG + Intronic
930454308 2:51585455-51585477 TTTTATTTGACGAAGGTGGTAGG + Intergenic
930687720 2:54326933-54326955 TTGTATTTTATGAATTTGGAGGG - Intergenic
930915427 2:56681540-56681562 TTTTCTTTTAAGAAAATACAGGG - Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931854160 2:66284125-66284147 TTTTATTTTAATACTCTGGAAGG - Intergenic
932021852 2:68095634-68095656 TTTTAATTTAAAAAATTGCAGGG - Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933360658 2:81279452-81279474 TTTTATGTATAGAAAGTGAAAGG + Intergenic
933460807 2:82582531-82582553 TTTTATTTAAGTGAAGTGGAAGG + Intergenic
933538997 2:83615289-83615311 TTATGTTTTAAGAAAGGCGAGGG - Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
933710310 2:85320445-85320467 TTTTATTAAAAAAAAATGGATGG + Intronic
934186131 2:89677911-89677933 TTTTTTTTTAAGAATGCTGAAGG + Intergenic
934315868 2:91919288-91919310 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
935352560 2:102165994-102166016 TTATATTTTTAGAAAGTGACTGG - Intronic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
935966995 2:108489024-108489046 TTATATTATAAGAAAGTAGAAGG - Intronic
936923640 2:117714580-117714602 ATTTACTTAAAGAAGGTGGAGGG - Intergenic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
938252314 2:129825629-129825651 TTTTGTTTCAAAAAAGTGGCTGG + Intergenic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
938876741 2:135539177-135539199 TTTTTTTTTAAATAAGTAGAAGG + Intronic
938883832 2:135622419-135622441 TTTTTTTTTAAGAATGTGCGTGG + Intronic
938996031 2:136679113-136679135 TTTTCTCTTAAGAAAGGGAATGG + Intergenic
939024919 2:137000828-137000850 TTTTATTTTTAGTAACTAGAAGG + Intronic
939362202 2:141186882-141186904 TTTGTTTTTAAGAATGGGGAAGG + Intronic
939429089 2:142079804-142079826 ATATATTTTAAGAAAGAGGCTGG - Intronic
939645201 2:144689137-144689159 TTTTCTTTTAAGATTGTGCATGG + Intergenic
939713339 2:145551665-145551687 TTATGTTTTAGGAAAATGGATGG - Intergenic
940034348 2:149297801-149297823 TTTGATTTTATAAAAGGGGAGGG - Intergenic
940061035 2:149568441-149568463 TTTTATTTTCATAATTTGGAGGG - Intergenic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940419430 2:153462027-153462049 TGGGATTTTAAGAAAGTGAAAGG - Intergenic
940438409 2:153683457-153683479 TTTTATCTTGAGAAAGTTCAAGG + Intergenic
940608791 2:155964013-155964035 TTCTATTATAAGAAAACGGAAGG - Intergenic
940709881 2:157149048-157149070 TTTTTTTTTTGGAAAGGGGAAGG - Intergenic
941128544 2:161617438-161617460 TTTCATTTTTAAACAGTGGATGG + Intronic
941481270 2:166017031-166017053 TTCTATTTTAAGAAATTAAAAGG - Intronic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941816923 2:169804835-169804857 TTTAATTTTAAAAAATTAGAAGG + Intronic
941938523 2:171007878-171007900 TTTTAATTTAAGAAATAGGCTGG - Intronic
942192565 2:173484658-173484680 TTGTATGTTAAGTAAGTGGCAGG + Intergenic
942454951 2:176130956-176130978 TTTTTTTTTAAGAAGGGAGAGGG + Intronic
942699587 2:178689653-178689675 ATTTTTTTTAAGAAAGCAGACGG + Intronic
943413695 2:187571711-187571733 TTTTAATTTAAGAAGGTCAATGG - Intergenic
943428365 2:187765362-187765384 TTATATTTTAATAAAGTTCAGGG + Intergenic
943800621 2:192053125-192053147 TTTTATTTTGAGAAAACAGATGG - Intronic
943829533 2:192442348-192442370 TTTTATTTTATTGCAGTGGAGGG + Intergenic
943898571 2:193401974-193401996 TTTTTTTTTCATAAAGTGTAAGG + Intergenic
944236158 2:197443138-197443160 TTTTATTTCAGGAGAGTGGAGGG - Intergenic
944556687 2:200894378-200894400 TGTTATTTTAAGAAGCTAGAAGG + Intronic
944969193 2:204972268-204972290 TTTTATTTTAACAAAATGGTAGG - Intronic
945161093 2:206891319-206891341 TTTTATTTTGAGAAAGCAAAGGG + Intergenic
945317430 2:208385058-208385080 CTGTACTTTAAGAAAATGGATGG + Intronic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946264807 2:218530229-218530251 TTTTTTTTTAAACAAATGGAAGG + Intronic
946390297 2:219411292-219411314 TTTTTTTTTAAAAAAGTGGCCGG + Intergenic
946721863 2:222617333-222617355 TTCTATTTTATATAAGTGGAAGG - Intronic
947012920 2:225585646-225585668 TTTTACTTTACGTAAATGGAAGG + Intronic
947093202 2:226536896-226536918 TTTGGGCTTAAGAAAGTGGAGGG - Intergenic
947359018 2:229328243-229328265 TTTTGTTTTTAGAAATTGGCAGG + Intergenic
948087576 2:235264404-235264426 TTTGCTTTGAAGAAAGAGGAAGG + Intergenic
948591196 2:239051316-239051338 TTCTATTTTCAGAAAGTGAGAGG - Exonic
1169635119 20:7681682-7681704 TTTGTTTTTAAGAAAATGTAAGG + Intergenic
1169892357 20:10466737-10466759 TTTTATTTTGGGAGAGGGGAGGG + Intronic
1170423964 20:16219843-16219865 TTCTATTTTAAGAATGTAGGTGG + Intergenic
1170654298 20:18271692-18271714 TTTTTTTTTAAGAAACAGGAAGG - Intergenic
1170733956 20:18997684-18997706 TTTTAATCTAAGAAAGTGGATGG + Intergenic
1170761011 20:19251697-19251719 TTTAATTCTAGGAGAGTGGAGGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171720480 20:28557447-28557469 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171784792 20:29452892-29452914 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171863591 20:30424747-30424769 TATTATTTTAAAAATGTTGAAGG - Intergenic
1172252925 20:33492329-33492351 TTTTATTTGAAAAAATTGGGGGG + Intronic
1172524492 20:35590743-35590765 TTTTTTTTTAAATCAGTGGAGGG + Intergenic
1173050606 20:39556927-39556949 TTTTATGTTAGGGAAGTTGAAGG - Intergenic
1173387704 20:42604295-42604317 ATTTATTTTAACAGAGAGGAAGG - Intronic
1173587707 20:44196127-44196149 TTTTTTTTTACCAAACTGGAGGG + Intergenic
1173958958 20:47056733-47056755 TTCTATTTTGAGAAAGAGCAGGG - Intronic
1174237612 20:49106976-49106998 TTTTTTTTTCAAAAAGTGGGTGG - Intergenic
1174249087 20:49204968-49204990 TTTTTTTTTATGACAGTGGGTGG - Intergenic
1174892408 20:54410372-54410394 TGCTATTTTAAGAAAGGAGAAGG + Intergenic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175027753 20:55920892-55920914 TTTTTTTTTAAAAAAGGGGTAGG - Intergenic
1175582183 20:60108772-60108794 TTTTTTTTTTAGTAAGTAGAAGG - Intergenic
1175584771 20:60129951-60129973 ATTTAATTTAAGAAAAAGGATGG + Intergenic
1176657306 21:9598744-9598766 TTTTATTTTCAGAAAGTCTGAGG + Intergenic
1177300327 21:19236051-19236073 TTTTTCTGTAAGAAAATGGATGG - Intergenic
1177323314 21:19550526-19550548 TGGTACTTTAAGAACGTGGAAGG + Intergenic
1177361625 21:20079659-20079681 TTTCATTTTAAGTATGTGTATGG + Intergenic
1177438861 21:21091855-21091877 TTTTATTTAAAAAAAGTCAAAGG - Intronic
1177471841 21:21569920-21569942 CTTTATTTTGGGAAAGTGGGGGG - Intergenic
1177533187 21:22389981-22390003 TTTTATTTTAAAAAATTACAAGG + Intergenic
1177722900 21:24929799-24929821 TTTTATTTTAAGACAGTAAGAGG - Intergenic
1177826980 21:26095148-26095170 TTTAATTTTAAGAAAGAGATAGG + Intronic
1178004836 21:28206620-28206642 ATTTATTATAAGAAAATGCAAGG + Intergenic
1178225387 21:30711172-30711194 TATTCTTTTAAGAAAGTAAATGG - Intergenic
1178712992 21:34936265-34936287 TTTTTTTTTAAAAAAGAGGGGGG - Intronic
1178942550 21:36918516-36918538 GTTTATTGTAAGAAAGTGGCTGG + Intronic
1179300595 21:40105762-40105784 CTATTCTTTAAGAAAGTGGAAGG - Intronic
1179398603 21:41063399-41063421 TGTTATTTGAAGAAAGGGAAGGG + Intergenic
1179819204 21:43926657-43926679 TTTTTTTTTAATAAAAAGGAGGG + Intronic
1180134232 21:45851211-45851233 CTTTGGTTAAAGAAAGTGGAAGG + Intronic
1180542637 22:16465161-16465183 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
1181784036 22:25213149-25213171 TTTTATTTCAAGAGAGTAAAAGG + Intergenic
1181824334 22:25502214-25502236 TTACATTTTAAGAAATTGGTTGG - Intergenic
1182049882 22:27304555-27304577 CTTTCTTTTATGAAAGTGGGAGG - Intergenic
1182192408 22:28475857-28475879 CTGTATTTTACGAGAGTGGATGG - Intronic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182535155 22:30995744-30995766 TTTTTTTTTCAGAGAGTGCATGG - Intergenic
1182949131 22:34355049-34355071 TTTGCTGTTAAGAAACTGGAAGG - Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
1184436680 22:44482980-44483002 TTTCATCTTAAGAAACTTGAGGG + Intergenic
949644705 3:6079250-6079272 TTTTATCTTATGAAATGGGAAGG - Intergenic
949845490 3:8366288-8366310 TTTTATTTTAAGGGAGGGAATGG - Intergenic
949849545 3:8409139-8409161 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
950052356 3:10002298-10002320 TTTTATTTTGAGATAGTGTCTGG + Intronic
950245700 3:11415766-11415788 TTTTTTTTTAAATAAGTAGAGGG + Intronic
950945621 3:16942736-16942758 TTTGCTTTTAAGGAGGTGGAAGG - Intronic
951046880 3:18049868-18049890 TTTCATTTTGAGAAACTGAAAGG - Intronic
951611003 3:24493775-24493797 ATTTATTTTAAGGAGGGGGAGGG - Intronic
951791355 3:26488211-26488233 CTTTAAATTAAGAAACTGGAGGG + Intergenic
952081402 3:29761976-29761998 TTTTATTTTATAAAATTGGATGG - Intronic
952162431 3:30707154-30707176 GTTTATTTTAAAAAAAGGGATGG + Intergenic
952280937 3:31922675-31922697 ATTTTTTTTAAAAAACTGGAAGG + Intronic
952320616 3:32274401-32274423 TTTTATTTTAAAAAAGTTCAAGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953144428 3:40261355-40261377 ATTTATTTTAGGTTAGTGGAAGG - Intergenic
953695188 3:45152738-45152760 TTTGATGGAAAGAAAGTGGAGGG + Intergenic
954165411 3:48753219-48753241 TCTTATTTTAAAAAATGGGAGGG - Intronic
954924831 3:54224280-54224302 TTTTTTTTTAATGAAGTAGAAGG + Intronic
955077546 3:55627898-55627920 TTTTTTTTGAAGAAAGGGGGCGG + Intronic
955211418 3:56945112-56945134 TCTTATTTTAAGAAATTGCCAGG + Intronic
955231138 3:57099590-57099612 GGTTATTTTCAGCAAGTGGATGG - Intronic
955231909 3:57107076-57107098 TTTTATTTTAAGAATTATGAGGG + Intronic
956060872 3:65346846-65346868 TTTTATTTTAGCAATGGGGAGGG + Intergenic
956254620 3:67270742-67270764 TTTTATTTTAAGCAAATGTGGGG + Intergenic
956365676 3:68499870-68499892 TTTTTTTTTAAGAAGCAGGAAGG + Intronic
956419842 3:69076052-69076074 TTTTATTGTATGAAAGTTAAAGG + Intronic
956482256 3:69685031-69685053 TTTTATTTTCAGAGAAAGGAAGG + Intergenic
956577901 3:70775729-70775751 TTATTTTATAAGAAAGTTGATGG - Intergenic
956927616 3:74005982-74006004 TTTTGGTGTAAGAAACTGGAAGG - Intergenic
957176220 3:76813638-76813660 TTTTATTTTAACATAGAGTAAGG - Intronic
957179301 3:76856548-76856570 ACTTAATTTAAGAAAGTGTAGGG - Intronic
957401708 3:79724251-79724273 TTTTATTTTAAGATGGTTAATGG + Intronic
957441930 3:80259561-80259583 TTTTTTTTTAAATAAGTAGAAGG + Intergenic
957584734 3:82119145-82119167 TTTTAGTGTAAGAAGTTGGATGG + Intergenic
958437754 3:94118681-94118703 TTTTTTTTTAAATAAGAGGAAGG - Intronic
958568628 3:95849598-95849620 TTTTTTTTTAAGAAACTGTATGG + Intergenic
958940828 3:100312148-100312170 TTTTATTCTGAGACAGGGGAAGG + Intronic
958953612 3:100442763-100442785 TTTTATTTTTAAAAAAAGGAGGG - Intronic
959257531 3:104033529-104033551 GTTTTTTTGAAGAAAGCGGAAGG - Intergenic
959600888 3:108183728-108183750 ATTTATTTTAACAAAGTCTAAGG + Intronic
959872578 3:111345379-111345401 GGCTATTTGAAGAAAGTGGAGGG + Intronic
960107323 3:113812290-113812312 TTTTACTTTGAGAAAGTGAATGG + Intergenic
960190633 3:114700942-114700964 TTCTTTTTTAAGAAATAGGAGGG - Intronic
960346999 3:116545405-116545427 TTTTCTTTTAAAAAAGAAGAAGG + Intronic
960352765 3:116613001-116613023 TTTTTTTTTAAGTAAGTGAGAGG - Intronic
960524346 3:118692288-118692310 TTTGATTTTTAGAAAGTTCATGG - Intergenic
960622367 3:119649073-119649095 ATTCATTTTAAGAATGAGGAAGG + Intronic
960670546 3:120151638-120151660 TTTGAATGTAAGAAAGTGGTGGG - Intergenic
960922504 3:122761623-122761645 TTTTTTTTTAACAAATTGGCTGG + Intronic
961348719 3:126284503-126284525 TTTTTTTTTAAATAAGTAGAAGG + Intergenic
961921578 3:130431974-130431996 TTTAATTTTAAGATAGAGGTAGG + Intronic
963278286 3:143355115-143355137 TTTGATTTTGAGTAAATGGATGG - Intronic
963371305 3:144404189-144404211 TTTTAGTTCAAGAATTTGGAAGG + Intergenic
964093957 3:152910105-152910127 TCTTATTTTACAAAAGAGGAAGG + Intergenic
964465765 3:156990153-156990175 TTTTATTTTTAAAAAGTGTGAGG - Intronic
964505045 3:157390341-157390363 TGTAATTTTAAGAAAGTCAAAGG + Intronic
964567588 3:158074389-158074411 TGTTATTTATAGGAAGTGGAAGG + Intergenic
964669897 3:159213607-159213629 TTTTTTTTCCAGAAAGTAGAAGG - Intronic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965014075 3:163132809-163132831 TTATATTTTAAGGATGGGGAAGG - Intergenic
965338465 3:167456995-167457017 TTATATAGTAAGAAAGTGGCAGG + Intronic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965467621 3:169051092-169051114 TTTTAATGTAAGAAGGTTGATGG - Intergenic
965812570 3:172606969-172606991 TTTTAATTTAAAAAATTAGAAGG + Intergenic
965918227 3:173877696-173877718 TTTTATTTTAAAAAAATTTAAGG - Intronic
965934564 3:174091385-174091407 TTTTCTTTTAAGTAACTGAAAGG - Intronic
966238722 3:177730913-177730935 TATTATTATAAGAAGGAGGATGG + Intergenic
966273593 3:178138590-178138612 TTTTATTTTAAAAAAATAAAAGG + Intergenic
966387287 3:179412839-179412861 TTTTTTTTTTCCAAAGTGGAGGG - Intronic
966471565 3:180294965-180294987 ATTTTTTTTAAGGAAGTGGTAGG - Intergenic
967065604 3:185912406-185912428 TTTTATGTAAAGAAACTGCAGGG - Intergenic
967250814 3:187536329-187536351 TTTTATTTTAAAATATTAGACGG - Intergenic
967282781 3:187838073-187838095 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
967691906 3:192484302-192484324 TTTTTTTTTAGGAAAATGGAAGG - Intronic
968160092 3:196419497-196419519 GCTTTGTTTAAGAAAGTGGATGG - Intronic
969745743 4:9069751-9069773 TTTTTTTTTAAGATAGAGAAGGG - Intergenic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
970198712 4:13579316-13579338 ATTTATTTTTTGAAAGAGGAAGG - Intronic
970500827 4:16675090-16675112 TTTTATTTTGAGATAATGGTAGG + Intronic
970504538 4:16714157-16714179 GTTTATCCTAAGAAACTGGAGGG + Intronic
970589135 4:17544106-17544128 ATTTATTTGAAGAAAGCAGAAGG - Intergenic
970674358 4:18431844-18431866 TAGTATTTTAGGAAAGTGGTGGG + Intergenic
970888015 4:21008829-21008851 TTTCTTTTTAAGAAACTGTAAGG + Intronic
970915602 4:21330482-21330504 TGTTTTTGTATGAAAGTGGATGG - Intronic
971280300 4:25237665-25237687 TCTCATTTTAAGAAAGTATAGGG + Intronic
971944772 4:33260112-33260134 TTTTATTTAGAGCAAGAGGAAGG - Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972482982 4:39515531-39515553 ATTTATGTTAAGAATATGGAGGG + Intronic
972678747 4:41285498-41285520 TTTTATTTTAGGAGAGTAAAGGG - Intergenic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973026037 4:45272525-45272547 TTTGATTTCATGAAAGTAGATGG + Intergenic
973219836 4:47712589-47712611 ATTTATTTTAAGGAAGTATATGG + Intronic
973895178 4:55405062-55405084 CTTTATTCAAAGAAGGTGGAGGG - Intronic
974057897 4:57002808-57002830 TTTTTTTTAAAGAAAGGGGGAGG - Intronic
974190826 4:58500483-58500505 TTTTATTCTAAGGAGGTGTAAGG - Intergenic
974198124 4:58603303-58603325 TTGACTTTTAAGGAAGTGGATGG - Intergenic
974266687 4:59595013-59595035 TTTTTTTTTGAGACAGTGTATGG + Intergenic
974340773 4:60612670-60612692 TTTTTTTTTCAGAAAGGTGATGG - Intergenic
974367486 4:60971267-60971289 TTTTATTTTTGGCAAGAGGAGGG - Intergenic
974549587 4:63353847-63353869 TTATATTTTAAGATAGGAGAGGG - Intergenic
974788437 4:66653349-66653371 TTTTATTTTCTGCAAGTGCATGG + Intergenic
974932268 4:68372921-68372943 TTTTCTTTTACAAAAGGGGAAGG - Intergenic
976089626 4:81442982-81443004 TATTCTTTTAAGAATGTTGAGGG - Intronic
976120938 4:81780585-81780607 TATTATTTTAAGAAGGTGAAGGG - Intronic
976343706 4:83974890-83974912 TTTCTGTTTAGGAAAGTGGAAGG + Intergenic
976912883 4:90329196-90329218 TTTTATTTTAATCAAGTACATGG + Intronic
977123557 4:93134939-93134961 TTTTATTTTCAGAGAGAGCACGG - Intronic
977256026 4:94740930-94740952 TTCTAATTTAAGAAAGTGGATGG - Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977831567 4:101600149-101600171 TTTTTTTGAAGGAAAGTGGAAGG + Intronic
977948131 4:102937399-102937421 TTTTTTTTTAAGAATGCTGAAGG - Intronic
977972643 4:103229494-103229516 TTTCCTTTTCTGAAAGTGGATGG - Intergenic
978326042 4:107557102-107557124 CTTTATTTAAAGAATTTGGATGG + Intergenic
978455496 4:108885685-108885707 TTTTATGTTAAAAAAGTATAAGG + Intronic
978510887 4:109516177-109516199 TTTGTTTTTAGGAAAGGGGAAGG + Intronic
978741595 4:112144248-112144270 TTTTATTCAAGGAAAATGGAAGG - Intergenic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
979020048 4:115485746-115485768 TTTTCTGTTAAATAAGTGGATGG + Intergenic
979050963 4:115932028-115932050 TTTTTTTTTAAGCAAATGTAGGG - Intergenic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
979469734 4:121080739-121080761 TTTTTTTTTAAAAAAAAGGAGGG + Intergenic
979624865 4:122833019-122833041 TTTAGTTTGAAGAAATTGGAAGG + Intronic
979805655 4:124967550-124967572 TTTGATTTTAAGAAAGGAAAGGG + Intergenic
980033219 4:127854460-127854482 TTTTGTTTTAAGAGAGTTGTAGG + Intergenic
980145293 4:128975337-128975359 TTTTATTTTTAAAAAGTTGTTGG - Intronic
980407539 4:132373033-132373055 TTTTTTTATAATATAGTGGAAGG + Intergenic
980645627 4:135638822-135638844 TTTTTTTTTTAGAAATTTGAAGG + Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981104094 4:140860948-140860970 TTTTTTTTCCAGAAAATGGATGG + Exonic
981425725 4:144600654-144600676 TTTTGGTCTAAGAAAATGGAAGG + Intergenic
981464174 4:145048148-145048170 TTTATTTTAAAGATAGTGGAGGG - Intronic
982176891 4:152714374-152714396 TTTTTTTTTAAGAAAGGAAATGG - Intronic
982496437 4:156099419-156099441 TTTAATTTTAAGAAAATGTGAGG - Intergenic
982505937 4:156218269-156218291 TTATATTTTAACAAAGAGGCTGG + Intergenic
983096650 4:163570442-163570464 TTTTATTTCAAGAAAGGGAAAGG - Intronic
983275277 4:165609315-165609337 TGCTATTTTAAGAAACTTGAAGG - Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
983909039 4:173215935-173215957 TTTTATTTTTAGAGAGAGAAGGG - Intronic
984371999 4:178880085-178880107 TTTTAATATGTGAAAGTGGAAGG - Intergenic
984953463 4:185023354-185023376 ACTTACTTAAAGAAAGTGGAGGG - Intergenic
985369766 4:189273839-189273861 TATTATTTTAAAAATGTTGAAGG + Intergenic
985770517 5:1807321-1807343 TTTCAGTTTACGAAGGTGGAAGG + Intronic
986641607 5:9877227-9877249 CTTATTTTTTAGAAAGTGGATGG + Intergenic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988793032 5:34626464-34626486 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989492323 5:42072456-42072478 TTTTTGTAGAAGAAAGTGGATGG - Intergenic
989503044 5:42191675-42191697 TTCTATTTTAGGAAGTTGGAGGG + Intergenic
989590557 5:43108970-43108992 TTCAATTTTAAGAAAATGAAAGG + Intronic
989961303 5:50418939-50418961 TGTAATTTTAATAAAATGGAAGG - Intronic
990460433 5:56026510-56026532 TTATATTATAAGAAACTGGGGGG + Intergenic
990688862 5:58339716-58339738 TTTAATTTTGAGAAAATGGTTGG - Intergenic
991385018 5:66077568-66077590 TTTTATTTTTAGAAAGTGTTGGG - Intronic
991500085 5:67268202-67268224 ATTTATTTCAAGAATGCGGAGGG - Intergenic
991545087 5:67772749-67772771 TTATTTTTAAAGATAGTGGAAGG - Intergenic
991973958 5:72167775-72167797 TTTTATTTAAAAAAAATGAAGGG - Intronic
992009334 5:72511102-72511124 TTTTGTTATATGAAAGTGCAGGG + Intergenic
992087653 5:73292288-73292310 TAATATTTTAAGAAAGTTTATGG + Intergenic
992260157 5:74961667-74961689 TTTTATTTTATTAAAATGTAAGG + Intergenic
992494193 5:77276200-77276222 GCTTATTTTAAGAAACAGGAAGG - Intronic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993371140 5:87093383-87093405 ATTTATTTTAATAAAGTGATGGG + Intergenic
993588477 5:89762274-89762296 TTTTATTTGAATAAAGTTTAGGG - Intergenic
993655294 5:90571006-90571028 TTCTTTTTTAAGAAACTGTATGG + Intronic
993733003 5:91445011-91445033 TTTTATTATAAGCATGTGAAAGG + Intergenic
993929434 5:93919760-93919782 TTTTACTATAAGCAAGTGGGAGG + Intronic
994163051 5:96578995-96579017 TATTGCTTGAAGAAAGTGGAAGG + Intronic
994336603 5:98574260-98574282 TTTTAATATGAGAAAGTTGAGGG + Intergenic
994361469 5:98853999-98854021 ATTTATTGTATAAAAGTGGAAGG + Exonic
994498138 5:100539070-100539092 TTTTTTTTAAAAAAAGTAGAGGG - Intronic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
995252290 5:110007233-110007255 TTTTTTTTAAAGAAGGTGGGAGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995511728 5:112917532-112917554 TTCTATTTAAGGAAAGGGGAAGG - Intronic
996146153 5:119979577-119979599 TTTTTTTTTAAGAAAAGGGCCGG - Intergenic
996311704 5:122113335-122113357 GTTTATTTAAAGGAAGTGGCGGG + Intergenic
996318478 5:122188003-122188025 TTTAATTAAAAGAAAGAGGAAGG + Intergenic
996932187 5:128903369-128903391 TTTTATTTTTAGAAAAAAGATGG + Intronic
997125502 5:131223016-131223038 TGCTATTTTAAGAAAATGGATGG - Intergenic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
997280286 5:132638970-132638992 TTTTATTTAAAAAAAGTCAAGGG - Intronic
997724225 5:136106730-136106752 TTTTATTCTAAAAAAAAGGAAGG + Intergenic
997981745 5:138471858-138471880 TTTTTTTTTAAGAGATGGGAGGG + Intergenic
998530401 5:142879270-142879292 TTTTATTTTAAGACATGGGGAGG + Intronic
998637743 5:143974677-143974699 TTTGCTTTTTAGAAAGTGCATGG + Intergenic
998828371 5:146130187-146130209 TTTTATTTTAAAGAAGGTGAGGG - Intronic
999375257 5:151081926-151081948 TTTTAATTCCAAAAAGTGGAAGG + Intronic
999848128 5:155507653-155507675 GTTTGTGTTAAGAAGGTGGATGG - Intergenic
999876197 5:155808814-155808836 TATTCATGTAAGAAAGTGGATGG + Intergenic
1000560566 5:162783381-162783403 CTGTATTTTAAGAAATTGGTTGG + Intergenic
1000672473 5:164079229-164079251 TTTTGTTTTATAAAAGTGAAAGG - Intergenic
1000880522 5:166692048-166692070 GTTTATTTCAAGTATGTGGAAGG + Intergenic
1001170552 5:169415213-169415235 TTTTATTTGAAGCAATTTGAGGG + Intergenic
1001378892 5:171289339-171289361 TTTTTTTCTAAGAAAGTTGAAGG - Intronic
1001459141 5:171893966-171893988 TTTTAATTTAAAAGAGGGGATGG + Intronic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1002892307 6:1345965-1345987 TTTCAGTTTAAAAGAGTGGAAGG + Intergenic
1002954319 6:1847056-1847078 TTTTATTTTAAAAAGGGGGTGGG - Intronic
1003311842 6:4975463-4975485 TTTTATTTTTAGAAAAAGAAAGG - Intergenic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003714751 6:8633908-8633930 TTTTGTTTTCAGTTAGTGGAGGG + Intergenic
1004074329 6:12331285-12331307 TTTTATTTTAAGGAAGGGAAAGG - Intergenic
1004646530 6:17567609-17567631 TTGGATTTTAAGAAAGTGTGTGG - Intergenic
1004658236 6:17685836-17685858 TTTTTTTTAATGTAAGTGGAAGG - Intronic
1004787393 6:18984453-18984475 TTTTATTTTAAAATTGGGGAAGG + Intergenic
1004948922 6:20646380-20646402 TTTTTTTTTAAATAAGTAGAAGG + Intronic
1004961476 6:20794560-20794582 TTTTGTATTAAGAAAGTGTGTGG - Intronic
1005038639 6:21581308-21581330 TCTTACTTTAAGATAGTGTATGG + Intergenic
1005201591 6:23351066-23351088 TTTTTTTTTCAGAAAGAGGGAGG + Intergenic
1005466487 6:26120960-26120982 TTTGACTTTAAGAAAGTGTTAGG - Intronic
1005717634 6:28566709-28566731 TTTTAATTTAAAAAATTTGAGGG + Intergenic
1005757397 6:28937455-28937477 TTTTTTTTTAAGACAGTGTCTGG + Intergenic
1006754620 6:36404641-36404663 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1007132414 6:39488021-39488043 TTTTATTTTAGATGAGTGGATGG - Intronic
1007133552 6:39499334-39499356 TTTTTTTTAAAGAAAGGGGAGGG + Intronic
1007555873 6:42765799-42765821 TTTTTTTTTAAGAACCTGTAGGG + Intronic
1007855497 6:44851650-44851672 TTTTGTTTTAAGGAACTAGAAGG - Intronic
1007969688 6:46038176-46038198 TTTTCATTTATGAAAGTGAAAGG - Intronic
1008065341 6:47041774-47041796 TTTTATTTTAAGAGATTGCAAGG + Intronic
1008511817 6:52283125-52283147 TTTTTTTTTCAAAAAGTGGGTGG - Intronic
1008572847 6:52831603-52831625 TTTAATTCCAAGAAAGTGGTAGG + Intergenic
1008574552 6:52847666-52847688 TTTAATTCCAAGAAAGTGGTAGG + Intronic
1008593889 6:53021784-53021806 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1008646201 6:53517417-53517439 TTTTATATTAAGAAAAGGTAGGG - Intronic
1008827576 6:55716132-55716154 TCTTATTTTAAAAAAATGAATGG - Intergenic
1008875997 6:56328744-56328766 ATATATTTTAAGATAGTGGGTGG - Intronic
1009560879 6:65241178-65241200 TATTATTTTAACAATGTGAAAGG - Intronic
1009577546 6:65485888-65485910 TTTTAATTTAATGAATTGGAGGG - Intronic
1009866351 6:69402361-69402383 TTTTATTTTTATAAAGTGCTGGG - Intergenic
1010138156 6:72580171-72580193 TTGTATTTTAAGAAAAGGAATGG - Intergenic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010176980 6:73040013-73040035 TTTTTTTTTAAGAAGGTGAGGGG - Intronic
1010412492 6:75576435-75576457 ATTATTTTTAAGAAACTGGAGGG - Intergenic
1010665122 6:78619927-78619949 TTTTCTTTTAAGAAAGAAGAAGG - Intergenic
1011468222 6:87680778-87680800 TTTTTTTTTAAAAAAAAGGAAGG + Intronic
1011861374 6:91761212-91761234 TTTTATTTGAAGAAGATGCATGG + Intergenic
1012447413 6:99321023-99321045 TTTTACTTTATTAAAGTGTAGGG - Intronic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1012640311 6:101602557-101602579 TTTTTTTTTAAAGAAATGGAGGG + Intronic
1013360091 6:109385829-109385851 TTTTTTTTTAATTAAGTGCAGGG - Intergenic
1013669496 6:112384041-112384063 TTTTATTTTAAGATATTAAAAGG + Intergenic
1013837545 6:114350367-114350389 TGTTATTTGAAGGAAGAGGAAGG - Intergenic
1013970152 6:116007930-116007952 TTTTATTTGAAAAAAATGAAGGG + Intronic
1014472665 6:121835470-121835492 TGTTATGTGAAGAAAGTTGAGGG + Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014906246 6:127032162-127032184 TCTTATCTTAAGAAAGTAGTTGG - Intergenic
1014993559 6:128113006-128113028 TTTTATTTGATGTAAGTGTATGG - Intronic
1015431869 6:133141299-133141321 TTTTAATTTAAGAAAATCAATGG - Intergenic
1015485175 6:133761554-133761576 TTTTAGTTTAGGAAAGAGCATGG - Intergenic
1015565441 6:134565214-134565236 TTTTATTTTGAGAAACTAAAAGG + Intergenic
1015784505 6:136907766-136907788 AAATATTTTAATAAAGTGGAGGG + Intronic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016319791 6:142830409-142830431 TTTTATTTTAAGAGGCTGGGAGG + Intronic
1016411469 6:143787742-143787764 TTTTATTTAAACAGAGTGGGTGG - Intronic
1016477960 6:144449152-144449174 TTTTATTGTCAGAAAGTGCAGGG + Intronic
1016695446 6:146988941-146988963 TGTTATTTTATGATAATGGAAGG - Intergenic
1017121036 6:151024104-151024126 TTTTTTTTTAATAAAGTACAAGG + Intronic
1017196772 6:151709993-151710015 TTTTTTTATATAAAAGTGGAAGG + Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017936470 6:159010051-159010073 TTTTATTTTTCAAAACTGGAAGG - Intergenic
1018270796 6:162075466-162075488 TTTATTTTTAAGAAAGGGAAAGG + Intronic
1018834642 6:167473748-167473770 TTTTATTTTCACTAAGTTGAGGG + Intergenic
1019401186 7:855021-855043 TTTTATTTTAAAAAAGCGTAAGG - Intronic
1019902439 7:4032153-4032175 TTTTATCTTAAGAGTGTTGATGG + Intronic
1021297816 7:18930644-18930666 TTTGATTTGAAGAAAGGGCATGG + Intronic
1021516027 7:21488175-21488197 TTTTATTTTAGGTAACTGGGTGG + Intronic
1021551829 7:21879136-21879158 TTTTTTTTTAAGAACGCAGATGG - Intronic
1021696534 7:23281737-23281759 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
1021916800 7:25442368-25442390 TTTTTCTTTAAGAATGCGGAGGG + Intergenic
1022334610 7:29410685-29410707 TTGTTTTTGAAGAAACTGGAGGG + Intronic
1022732083 7:33036768-33036790 TTTTAATGTAAGAAAATTGAAGG - Intronic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1023153600 7:37225551-37225573 TTTTCGTTTAAGAGAGTGGCCGG - Intronic
1023427483 7:40053761-40053783 TTTTTTTTTAAGAAAAAGAAGGG + Intronic
1023469382 7:40497935-40497957 AATTATTTTAAGATAGTGGGTGG - Intronic
1023475764 7:40576112-40576134 TTTTATTTTATGTAAATGAAAGG - Intronic
1023580289 7:41675018-41675040 TTTTATTTTAATATACTTGAGGG - Intergenic
1023598950 7:41862630-41862652 AGTCATTTTAAGAATGTGGATGG + Intergenic
1023601224 7:41883568-41883590 TTTCCTTTTAAGAAACTTGATGG + Intergenic
1024784838 7:52895473-52895495 TTTTGTTTTTAGTAAGTAGAAGG - Intergenic
1024797809 7:53038483-53038505 TTTTCTTTTAAGAAAGGATAGGG + Intergenic
1025172648 7:56774004-56774026 TTTTATTTGAAAAATGTGGCTGG - Intergenic
1025727939 7:64083911-64083933 TTTTAATATAAAAAAGTAGAAGG - Intronic
1025771499 7:64511623-64511645 TTTTTTTTAAAGAAAGTGTCTGG - Intergenic
1025978450 7:66388169-66388191 TTTTTTTTTGAGAAAGTGTCTGG + Intronic
1027204032 7:76082824-76082846 TTTTTTTTTGAGAAAGTGTCTGG + Intergenic
1027511953 7:79094013-79094035 TCTTATTTTAAGAAATTGCTGGG - Intronic
1027559756 7:79714031-79714053 TTTTATTTCAAAAAAGTTCATGG - Intergenic
1027630375 7:80596828-80596850 TTTTGCTCTAAGAAAGAGGATGG + Intronic
1027805694 7:82818866-82818888 TATTATTTTCAGAATGCGGATGG + Intronic
1027816900 7:82985735-82985757 TTTTGTTTTAAGAATGTGTAAGG + Intronic
1027824183 7:83089641-83089663 TCTTCTTTCAAGTAAGTGGAAGG - Intronic
1028432676 7:90765608-90765630 TTTTTTTTTAAGAATGTTAAGGG + Intronic
1028681738 7:93542965-93542987 TTTTTTTTTAAGTAAGTAGAAGG + Intronic
1028715906 7:93968009-93968031 TATTACGTTAAGAAAATGGAAGG - Intronic
1028980613 7:96964023-96964045 TTTAAAATTAAGTAAGTGGAAGG - Intergenic
1029142643 7:98422458-98422480 TATTTTTTTTAGTAAGTGGATGG - Intergenic
1029875967 7:103752114-103752136 TTTTGTTTTCATAAAGTGTATGG - Intronic
1030110061 7:106019396-106019418 TTTTTTTTAAAGAAAATGAATGG + Intronic
1030335398 7:108319922-108319944 ATGTATTTTAAGAAAGCTGAGGG + Intronic
1030860300 7:114616900-114616922 TTTTATTTTTAGAGATGGGAGGG - Intronic
1030944839 7:115705097-115705119 TTTTAATTTTATAAAGGGGAAGG - Intergenic
1031108077 7:117570180-117570202 TTTTTTTTTAAGTAAGGAGATGG - Intronic
1031523877 7:122800287-122800309 TTTTATTTTGAGAAATCTGAAGG - Intronic
1031655968 7:124355655-124355677 TTTAATTCAAAGAAAATGGAAGG - Intergenic
1031797403 7:126193528-126193550 TTTTATTTCTAGAAAGGGCAAGG - Intergenic
1031984954 7:128158148-128158170 TTTCAATTTGAGAAAGTGGGTGG - Intergenic
1032374740 7:131401216-131401238 CTGTATTTTAAGAAAGTGTAAGG + Intronic
1032474263 7:132201718-132201740 TTTTATTTTAAGAGGGAGCAAGG + Intronic
1032556233 7:132838033-132838055 TTTTATTATACAAAAGTGAATGG + Intronic
1032583521 7:133125690-133125712 TTTTATTTAGAGAAAGAGCAAGG - Intergenic
1032826237 7:135571284-135571306 TTTTTTTTTAAGATCGAGGAAGG + Intronic
1032837337 7:135686374-135686396 TTTTTTTTTAATTAAGAGGAGGG + Intronic
1033227358 7:139572621-139572643 TTTTATTTTAAAAAAGAAAAAGG - Exonic
1033601740 7:142893605-142893627 TTTTTTTTTAAGGAGGTGGTGGG - Intergenic
1033713091 7:143969645-143969667 TTTTATTTTTAGTAAATGCAGGG - Intergenic
1034076954 7:148241285-148241307 TTTGCTTTTAAGAAAGAGAAGGG - Intronic
1034605003 7:152304143-152304165 TTTTAATCTAAGAAAATGGAAGG - Intronic
1034758921 7:153652624-153652646 TTTTTTTTTAAAAAAATGTAGGG + Intergenic
1034796058 7:154014753-154014775 CTTTGTTTTTAGAACGTGGAGGG - Intronic
1034834863 7:154342793-154342815 TTTAACTTTTAGGAAGTGGACGG - Intronic
1034875181 7:154719338-154719360 TTTAATTTCAAGCAAATGGAAGG - Intronic
1034893738 7:154862030-154862052 TTTGATTTTAACAAAATGGAAGG - Intronic
1035133582 7:156677863-156677885 TTTTATTCTAAGAGAGCAGAGGG + Exonic
1035711950 8:1724253-1724275 TTTAATTATGAGAAACTGGAAGG + Intergenic
1036295865 8:7536796-7536818 TTTTTTTTTATGAAAGAGGGTGG - Intergenic
1036326701 8:7784224-7784246 TTTTTTTTTATGAAAGAGGGTGG + Intergenic
1036521035 8:9491864-9491886 TTTGATTTTGAAAAAGAGGATGG - Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1037577590 8:20222658-20222680 TTTTATTTTCAGCAAGTGTGAGG + Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1038081688 8:24144573-24144595 TTATGTTTTAAGAAGATGGATGG + Intergenic
1038205966 8:25465580-25465602 TTGTATTTTAAGAGAATGGCTGG + Intronic
1038250484 8:25899572-25899594 TTTTATTTAAGGAAAATAGATGG + Intronic
1038389585 8:27182906-27182928 TTTTTTTTTAAAGAAGTGCAGGG - Intergenic
1038529004 8:28301799-28301821 TTTTTTTTTAAAAAAAAGGAAGG - Intergenic
1038737865 8:30188722-30188744 TTTTATTTGAAGACAGGGGCTGG + Intergenic
1038840004 8:31175992-31176014 TTTTTTTTTAAGAGTATGGAAGG + Intergenic
1039376098 8:37035833-37035855 TTTGAATTAAAGAAACTGGAAGG + Intergenic
1039758269 8:40546196-40546218 TTTCTTTTTAAAAAAGAGGAAGG + Intronic
1040485798 8:47869943-47869965 CTTTATTTTAGGAAAGGAGAGGG + Intronic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041297166 8:56369407-56369429 TTTTTTTGTAAGAAAGCTGAAGG - Intergenic
1041430102 8:57771034-57771056 TTCAATGTAAAGAAAGTGGAAGG + Intergenic
1042132484 8:65601372-65601394 TTTTATTTTTAAAAAATGGGAGG - Intergenic
1042290242 8:67163344-67163366 TTTTTTTTTAAGAAAGGGAGAGG + Intronic
1043126063 8:76396936-76396958 CTTAATTTTAAGAAAGTGAGAGG - Intergenic
1043267154 8:78280410-78280432 TTTTATTTTACAAAGGTGGAGGG - Intergenic
1043373432 8:79620329-79620351 TTTTATTACAGGACAGTGGAGGG - Intronic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1043920328 8:85975207-85975229 TTTTTTTTTAATAAACAGGAGGG - Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1044975609 8:97662338-97662360 TTTTTTTTTAAAAAGGGGGAGGG - Intronic
1045144050 8:99318995-99319017 TTTTATTTCAAGATAGTAAAGGG - Intronic
1045223713 8:100223895-100223917 TTTAAGTTTAAGAAACTGTAGGG + Intronic
1045224777 8:100233807-100233829 GTTCATTTTAAGATAGAGGAAGG + Intronic
1045685497 8:104707173-104707195 TTTTATCTTAAGGAAGAAGAGGG + Intronic
1045714274 8:105023164-105023186 TTCTATTTTAAGGAAGTGACAGG + Intronic
1046668009 8:117026345-117026367 TTTTCTTTTAAGAAAGCATAGGG + Intronic
1046850768 8:118970240-118970262 AATTATTGTAAGAAAGAGGAAGG + Intergenic
1047232315 8:123008059-123008081 TTTTATTTTAAAAAAATTAAGGG - Intergenic
1047329965 8:123878013-123878035 TTCTATTCTAATAAAATGGAGGG + Intronic
1047557707 8:125950592-125950614 TTTTTTTGGAAGAAAGTGGGTGG + Intergenic
1047595050 8:126369998-126370020 TTTTCTATTAAGAAAGTGAGAGG + Intergenic
1047802739 8:128326811-128326833 TCTTATTTTAAGAAAGGAGCAGG + Intergenic
1048013135 8:130474606-130474628 TGTCATTATAAGAATGTGGAAGG + Intergenic
1048155919 8:131951073-131951095 TTTTATTTTAAGATAATTAAAGG + Intronic
1048310273 8:133316957-133316979 TTTTTTTTTAAGAGACAGGATGG + Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1050541813 9:6676845-6676867 TTTCTTTTTAAGAAAGGGTATGG - Intergenic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1051202894 9:14648779-14648801 TTTTATTTTAATAAATTGTGAGG - Intronic
1051412433 9:16804549-16804571 TTTTATTTTGAAAAATTGAAAGG - Intronic
1051787587 9:20762286-20762308 TTTTAGTTTCCGAAAGTAGAAGG + Intronic
1051824434 9:21203943-21203965 TTCTATTATAACAAAGTAGAGGG - Intergenic
1051846910 9:21462322-21462344 TTCTATTATAAAAAAGTAGAGGG + Intergenic
1051880923 9:21839180-21839202 TTTTTTTTTAAAAAAGTGGCAGG + Intronic
1051959465 9:22740542-22740564 TTTTATTTGAAGCAAGTGGTAGG + Intergenic
1052470801 9:28893587-28893609 TTTTAATTTAAAAAATTTGATGG + Intergenic
1052800872 9:32966870-32966892 TTTTATTTTTAAAAAGTGATAGG - Intergenic
1052987685 9:34500159-34500181 TCTAACTTAAAGAAAGTGGAAGG + Intronic
1055045331 9:71918249-71918271 TTTTGTTTTGGGAAAGTTGAAGG + Intronic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055418036 9:76105580-76105602 TTTTATGTTAAGAAACTGTCTGG - Intronic
1055493067 9:76825961-76825983 TTCTATTTTGAGAAGATGGAAGG - Intronic
1055560990 9:77521555-77521577 TTCCATTCTCAGAAAGTGGAAGG - Intronic
1055691845 9:78840654-78840676 TTTCATTTTCATTAAGTGGATGG - Intergenic
1055780697 9:79818374-79818396 TTTTATTTTAGGCCAGTTGAAGG + Intergenic
1056231528 9:84550476-84550498 TTTTATTTAAACAAAGAAGAGGG + Intergenic
1056235886 9:84593890-84593912 TTATATTTTATAAAAGTTGAAGG - Intergenic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1057403208 9:94742850-94742872 TTATATTTTATGAAAGTATAAGG + Intronic
1057709567 9:97427133-97427155 TTTTATTAAAGGAAAGAGGAAGG - Intronic
1057738021 9:97684549-97684571 TTTCATTTTAAGCAATTAGAGGG + Intronic
1058292523 9:103259602-103259624 TATTATTTTAAGAAAATGAGTGG - Intergenic
1058306656 9:103451701-103451723 TTTTATTTTAAGTAAATGAGGGG + Intergenic
1058326555 9:103705630-103705652 CTAAATTTTAAGAAAATGGAAGG + Intergenic
1058326676 9:103707149-103707171 TTTTATGTTAAGTACATGGAGGG - Intergenic
1058361525 9:104152357-104152379 TTTTAGTTTAAAAGAATGGAAGG - Intergenic
1058409191 9:104712042-104712064 GTTTATTTTCAGAAAGGAGAGGG + Intergenic
1058802693 9:108560216-108560238 TTTTATTTTGTTAAATTGGAGGG - Intergenic
1059254434 9:112916300-112916322 TTTTTTTTTAAGAAAGTTTAAGG - Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059592043 9:115672231-115672253 TTTTGTTTTGAGCAATTGGATGG + Intergenic
1059597065 9:115732457-115732479 TTTTTTTTTTAGAAAGGGCAGGG - Intergenic
1059721383 9:116963449-116963471 TTTTATTTTGAGGCAGTTGAAGG + Intronic
1059843897 9:118249498-118249520 ATTGATTTTAAAAAAGTGAAGGG + Intergenic
1059858122 9:118424437-118424459 TTTTTTTCTAAGAAACTGAAAGG - Intergenic
1060365443 9:123007567-123007589 TTTTTTTTTAAGAAAGAGATGGG + Intronic
1060617493 9:125031543-125031565 TATTTTTTTAAAAAAGTGGCCGG - Intronic
1060844235 9:126822440-126822462 TCCTATTTTAAGAAATTGGCAGG + Intronic
1060908516 9:127329819-127329841 TTTTATTTTAAGACAGGACAGGG - Intronic
1061380094 9:130250783-130250805 CTTTAGTTTATTAAAGTGGAAGG + Intergenic
1062299240 9:135855448-135855470 TTTTACTTTAAGAAGCTGGCTGG + Intronic
1203445584 Un_GL000219v1:52062-52084 TATTATTTTAAAAATGTTGAAGG + Intergenic
1203635028 Un_KI270750v1:102319-102341 TTTTATTTTCAGAAAGTCTGAGG + Intergenic
1185604127 X:1357800-1357822 TTTTTTTTTAAGAAAATAAATGG + Intronic
1186257101 X:7733545-7733567 TTTTACTTTAATAAAGTTGGAGG + Intergenic
1186367687 X:8912629-8912651 TTTGATTTTAATAAAGTTAATGG + Intergenic
1187020134 X:15373048-15373070 TTTTATTTTGAAAAATTGGTTGG - Intronic
1187242412 X:17525651-17525673 TTTTTTTTTACTACAGTGGAAGG + Intronic
1187574148 X:20536548-20536570 TTTTGTTTTAACAAAGTGATGGG + Intergenic
1187617858 X:21017669-21017691 TTTTGTTCTCAGCAAGTGGAGGG - Intergenic
1187736223 X:22306510-22306532 TTTTATTTTGAGACAATGAAGGG + Intergenic
1187847724 X:23558012-23558034 TTTCATTATATGAAACTGGAAGG - Intergenic
1187861450 X:23687481-23687503 TTTTGTATTAAGAGAGGGGATGG - Intergenic
1188135805 X:26493326-26493348 TTTGATTTTAAGATAATGAAGGG + Intergenic
1188278738 X:28236531-28236553 TTTTATTTTAAGACATTGGGTGG - Intergenic
1188294139 X:28425632-28425654 ATTTATTTAAATAAAATGGAAGG - Intergenic
1188720347 X:33515688-33515710 TTTTTGTTTAAGAAAGTTGGTGG - Intergenic
1189420319 X:40851463-40851485 TTTTGCTTTAAGGAAGTTGAAGG + Intergenic
1189532112 X:41895863-41895885 TTTTTTTTAAAGCAAGTGGTGGG + Intronic
1190077416 X:47328013-47328035 TTTTATTTTAAGAAAGTGTTGGG + Intergenic
1190122704 X:47675437-47675459 TTTTGTTTTAGCAAAGTGTAAGG + Intergenic
1191703750 X:64070950-64070972 TTTTACTTAAGAAAAGTGGAAGG + Intergenic
1191930789 X:66368955-66368977 TATTATTTAAAGAAATTGAAAGG - Intergenic
1192836392 X:74804311-74804333 TTTTACTTGAGAAAAGTGGAAGG - Intronic
1193148700 X:78103639-78103661 TTTTATTTTAAAAAAGGTGGGGG + Intronic
1193539680 X:82755977-82755999 TGTTTTGTTAAGAAAGAGGAAGG + Intergenic
1194042076 X:88953424-88953446 TTTTATGTTAAGAAAGTTGGTGG - Intergenic
1194326222 X:92520612-92520634 TCTTATTTTAAGAAATTGCCAGG - Intronic
1194737689 X:97532748-97532770 TTTTATGTTAAGTAAGGAGAAGG - Intronic
1194878272 X:99217788-99217810 TTTAATTTTTAGAATGTGTAGGG + Intergenic
1194904193 X:99553601-99553623 TTTTATTTTAAAAAATTTAAGGG + Intergenic
1194914029 X:99683266-99683288 CTTTATTTTGAGCAAGTAGAAGG - Intergenic
1194916268 X:99713002-99713024 TATTACTTTAAGAAGGTGGTAGG + Intergenic
1195060061 X:101185621-101185643 TGTTAATTTTAGAAACTGGAAGG + Intergenic
1195338694 X:103882865-103882887 TTCTATTATGGGAAAGTGGATGG - Intergenic
1195778506 X:108434620-108434642 ATATATTTTAAGATAGAGGAGGG - Intronic
1196112532 X:111962819-111962841 TCTTATTTTAAGAAATTGCCGGG + Intronic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1196881418 X:120201190-120201212 TTTGTTTTTTAGAAAGTGGGTGG - Intergenic
1197047246 X:122012325-122012347 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
1197669240 X:129257658-129257680 TTTCAGTTTCAGAAAGTGTAAGG - Intergenic
1197691518 X:129505772-129505794 TTTTATTTTCATTAAGTTGAAGG - Intronic
1197698132 X:129572983-129573005 TTTTATTTTCACAACCTGGAAGG - Intronic
1197964025 X:132037111-132037133 TTTTATTATATGAAAATGTATGG + Intergenic
1198012819 X:132576213-132576235 TTTTAATTTAAAGAAGTGGCTGG - Intergenic
1198088235 X:133301731-133301753 TTTTGTTTTAAGAGAGTATAAGG - Exonic
1198476888 X:137003447-137003469 TTTTAATTGAAGCATGTGGACGG + Intergenic
1198537079 X:137597273-137597295 TTTTATTTTAAAAAATGGGTAGG + Intergenic
1198673137 X:139103077-139103099 TTTTATTGTGGGAAAGTGCAAGG - Intronic
1199503914 X:148540287-148540309 TTTAATTTTAAGAATGCAGAAGG - Intronic
1199522988 X:148758391-148758413 TTTTATTTTAAAAAAGTTACAGG - Intronic
1199938781 X:152603659-152603681 TTTTATTTTAAGAAAATGATGGG - Intergenic
1200634939 Y:5639814-5639836 TCTTATTTTAAGAAATTGCCAGG - Intronic
1201058788 Y:10022942-10022964 TTTTATTTAAAAGAAGTGTAAGG + Intergenic
1201183527 Y:11374094-11374116 TTTTTTTTTAAGAATGCTGAAGG - Intergenic
1201339246 Y:12914873-12914895 TTATGTTTTAGGAAAATGGAAGG + Exonic
1201349026 Y:13018936-13018958 TTTAATTTTAAAAAACTGGTGGG - Intergenic
1201619010 Y:15934284-15934306 TATTTTTTTAAGGATGTGGAGGG + Intergenic