ID: 953123111

View in Genome Browser
Species Human (GRCh38)
Location 3:40065134-40065156
Sequence GTTGTCAAACCACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953123111_953123113 -2 Left 953123111 3:40065134-40065156 CCAGCTTCTGGTGGTTTGACAAC 0: 1
1: 0
2: 1
3: 18
4: 130
Right 953123113 3:40065155-40065177 ACCTTTGGTGCTCCTTTGCTTGG 0: 1
1: 0
2: 2
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953123111 Original CRISPR GTTGTCAAACCACCAGAAGC TGG (reversed) Intronic
902092393 1:13913864-13913886 ATTCTCAAACCACCTGAAGCAGG - Intergenic
905267451 1:36764676-36764698 GTCCTGAAGCCACCAGAAGCTGG - Intergenic
905399239 1:37689992-37690014 GTTGTCTCACCTCCAGAAGCAGG + Intronic
910285250 1:85546447-85546469 GCTGTAACACCACCACAAGCTGG - Intronic
913059446 1:115191445-115191467 GGTGTCAAACCACAAGACCCTGG - Intergenic
915641840 1:157233601-157233623 TGTGTCAAAACACTAGAAGCAGG - Intergenic
917505626 1:175624564-175624586 GTCTGCAAACCACCAGAAGCTGG + Intronic
919043690 1:192424740-192424762 GCTGTCAACCCCCCAGCAGCAGG + Intergenic
920456045 1:206101885-206101907 GTTGACAAAATACCAGAAACTGG - Exonic
921393012 1:214635945-214635967 CTTGTCAAGCCTCCAGATGCAGG + Intronic
921519044 1:216136827-216136849 GCCAGCAAACCACCAGAAGCTGG + Intronic
1065604540 10:27403997-27404019 CTTGGCAAACCAACAGAAACAGG + Intronic
1068128244 10:52867301-52867323 GGCAGCAAACCACCAGAAGCTGG - Intergenic
1073492155 10:103859787-103859809 GTTGCCAAACTACCAGATGGTGG + Intergenic
1074358388 10:112805762-112805784 GCTGACAACCCACCAGAAGCTGG + Intronic
1074500107 10:114016067-114016089 GGTGTTACACCACCAGAGGCTGG + Intergenic
1077409029 11:2395015-2395037 GTTGACAAAGCCCCAGATGCCGG - Exonic
1082227392 11:49725017-49725039 GCTGTCAAACCCTCAGAAGCTGG + Intergenic
1082872557 11:57956789-57956811 GTTGTCATAGCAGCAGAACCTGG + Intergenic
1086622029 11:88898091-88898113 GCTGTCAAACCCTCAGAAGCTGG - Intronic
1087009674 11:93501459-93501481 AATGCCAAGCCACCAGAAGCTGG - Intronic
1096716357 12:53493724-53493746 GTCGTCAAACAACCAGATGACGG - Exonic
1099267006 12:80460881-80460903 ATTGTCAGAACACCAGAATCAGG + Exonic
1099932982 12:89095022-89095044 GCTAGCAAACCACCAGAAGCTGG + Intergenic
1104802838 12:131566424-131566446 GTTATCAAATCACCTGGAGCAGG + Intergenic
1106323093 13:28660235-28660257 ATTGTTGAACCACCAGAAGTTGG - Intronic
1106377305 13:29202497-29202519 TTTGACAAACCAACAGAAGGAGG - Intronic
1107566815 13:41613544-41613566 GTGGTGGAACCATCAGAAGCTGG + Intronic
1108555582 13:51588553-51588575 CTTCTCTAACCACCACAAGCAGG - Intronic
1110494657 13:76152962-76152984 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1111928617 13:94490157-94490179 GGTGTAAAACCACCAGATTCAGG - Intergenic
1111946283 13:94669017-94669039 GCCAGCAAACCACCAGAAGCAGG + Intergenic
1114409473 14:22487159-22487181 GTTGTAAAACTCCCTGAAGCAGG + Intergenic
1116366747 14:44076412-44076434 GTGGTCAAAGCATCAGAAGCAGG + Intergenic
1120092087 14:80343764-80343786 GCAGACAAACTACCAGAAGCTGG - Intronic
1120840993 14:89084608-89084630 GCCGGCAAACCACCAGCAGCTGG - Intergenic
1121062267 14:90923730-90923752 GTTGTCAAACCTACACAAGATGG - Intronic
1129297104 15:74605545-74605567 GCTGGCAAAGCACCAGAAGCTGG + Intronic
1131596814 15:93806398-93806420 GTTGTCAAGCCACTAGTAGCTGG + Intergenic
1133973474 16:10583262-10583284 ATTATCGAAACACCAGAAGCAGG - Intergenic
1137020954 16:35426929-35426951 GTTTACAAAACACAAGAAGCAGG - Intergenic
1138307512 16:55990651-55990673 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1138768217 16:59630019-59630041 TTTTTGAAGCCACCAGAAGCTGG + Intergenic
1139073289 16:63411052-63411074 TATGTCAAACCACCATAAGTTGG - Intergenic
1141699831 16:85637333-85637355 GTCGTCCAGCCACGAGAAGCAGG - Intronic
1148607957 17:48944520-48944542 GCTGCCAATCCACCGGAAGCTGG + Intronic
1149150665 17:53559672-53559694 GGTGTCACACCAATAGAAGCAGG + Intergenic
1149276041 17:55038512-55038534 GTTGTCAAACAAACAAAAGTAGG - Intronic
1149616791 17:58007435-58007457 GTTCGCAAACCACCCCAAGCTGG - Intergenic
1157755088 18:50210573-50210595 GTGGGCAGACCCCCAGAAGCTGG - Intergenic
1157806392 18:50661096-50661118 GTTTACAACCCAGCAGAAGCTGG + Intronic
1158201662 18:54948360-54948382 ACTAGCAAACCACCAGAAGCAGG + Intronic
1161747173 19:6068121-6068143 GAGGTCAAATCACCAGCAGCTGG + Intronic
1162201690 19:9025113-9025135 GTTAGCAAACAACCAGACGCTGG + Intergenic
925614702 2:5734406-5734428 GCCGGCAAACCACCAGAAGGTGG + Intergenic
927098856 2:19771330-19771352 GTCAGCAAACCACCAGAAGCTGG - Intergenic
927358556 2:22204657-22204679 GCCAGCAAACCACCAGAAGCTGG + Intergenic
930608404 2:53515794-53515816 GTTTTCAAACCAACAGGAGTGGG - Intergenic
931044946 2:58341116-58341138 CTTGTCCCACCACCAGCAGCAGG + Intergenic
931485387 2:62685411-62685433 GCCATCAAACCAACAGAAGCTGG - Intronic
931645230 2:64416210-64416232 GTTTTGTGACCACCAGAAGCTGG - Intergenic
933263839 2:80159400-80159422 GTTGTGAAAACACCAAATGCTGG - Intronic
935668628 2:105536275-105536297 GCCAGCAAACCACCAGAAGCTGG + Intergenic
935945738 2:108285056-108285078 GCCTGCAAACCACCAGAAGCTGG + Intergenic
936598458 2:113872441-113872463 GCCAGCAAACCACCAGAAGCTGG + Intergenic
941595831 2:167475863-167475885 GCAGGCAAACCACCAGAAGCTGG - Intergenic
942496894 2:176549363-176549385 GAAGTAAAACCAGCAGAAGCTGG - Intergenic
943991096 2:194693527-194693549 GTTGCCAGAACACCTGAAGCTGG + Intergenic
945335541 2:208588574-208588596 GGGGACAAACCACCAGAAGCGGG + Intronic
947076354 2:226349941-226349963 GACAGCAAACCACCAGAAGCTGG + Intergenic
947990499 2:234484024-234484046 GCCAGCAAACCACCAGAAGCTGG + Intergenic
948041244 2:234903356-234903378 GCAGGCAATCCACCAGAAGCTGG + Intergenic
948287878 2:236801048-236801070 ATTGCGCAACCACCAGAAGCTGG - Intergenic
948951239 2:241253235-241253257 GTTCTGAAACAACCAGAAGCTGG - Intronic
1169909583 20:10636588-10636610 GTTTACAAACCACCAGAACAAGG + Intronic
1171121517 20:22572731-22572753 GTTGTCAGGCCACCAGGTGCAGG + Intergenic
1180235410 21:46456558-46456580 GCCAGCAAACCACCAGAAGCTGG + Intergenic
1182823650 22:33242863-33242885 GCCAGCAAACCACCAGAAGCTGG - Intronic
1183383403 22:37501783-37501805 GTTGTAAAACAGCCAGCAGCTGG + Intronic
1183886046 22:40883114-40883136 GTTGTCAAATATCAAGAAGCTGG - Intronic
950779423 3:15378617-15378639 GTTGTCAGACACCCAGAAGGAGG + Intergenic
951993604 3:28702783-28702805 TGTGTTAAACCACCAGAAGCTGG - Intergenic
952703079 3:36346816-36346838 GTTGTGAAATCACCTGAAGTAGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953123111 3:40065134-40065156 GTTGTCAAACCACCAGAAGCTGG - Intronic
958263132 3:91405742-91405764 GCCAACAAACCACCAGAAGCTGG + Intergenic
961205882 3:125081201-125081223 GATCACAAGCCACCAGAAGCTGG + Intergenic
963108960 3:141669753-141669775 ATTGTCAGACCAACAGAAACTGG + Intergenic
965474180 3:169133509-169133531 GTAGTTGAACCACCTGAAGCTGG + Intronic
968280581 3:197473875-197473897 GCTGGCAAACCACCGAAAGCAGG - Intergenic
971216301 4:24665350-24665372 GGTGTAACACCATCAGAAGCTGG - Intergenic
973829431 4:54743338-54743360 GCCAGCAAACCACCAGAAGCTGG - Intergenic
974515880 4:62909480-62909502 GTTGTCAAACCTACACAATCCGG + Intergenic
977731830 4:100363085-100363107 CTAGTCTTACCACCAGAAGCGGG - Intergenic
983375765 4:166925908-166925930 GTTGTTAAACAAACAGAAACTGG - Intronic
983469121 4:168135375-168135397 GTTGTCAAACTGCAAGAGGCTGG + Intronic
984199543 4:176700579-176700601 GTTGGAAAGCCACCAGAAGTGGG + Intronic
985041210 4:185893535-185893557 ATTATCAAACCTTCAGAAGCTGG - Intronic
986049214 5:4071401-4071423 GTCAGCAAAACACCAGAAGCCGG - Intergenic
987549582 5:19361210-19361232 GCTATCAAGCCACCAGAAGCTGG - Intergenic
988692023 5:33581942-33581964 GACGTCAAACCACCAGAAGCTGG + Intronic
988801387 5:34699405-34699427 GCCAGCAAACCACCAGAAGCTGG - Intronic
998425097 5:142019654-142019676 GATGTGAAACCACCAAAAACTGG + Intergenic
999191111 5:149748075-149748097 GTTGTGAAACAACCAGAGGAGGG + Intronic
999706067 5:154273301-154273323 GTGGAGAAACCACCAGAATCAGG - Intronic
1003500881 6:6701835-6701857 ATATTTAAACCACCAGAAGCTGG + Intergenic
1004505330 6:16242530-16242552 GTCAGCAAACCAGCAGAAGCTGG - Intronic
1006469414 6:34218609-34218631 GCAGGCAAGCCACCAGAAGCTGG + Intergenic
1008992276 6:57617146-57617168 GCTAACAAACCACCAGAAGCTGG - Intronic
1009969937 6:70615425-70615447 GCTGGCATACCATCAGAAGCTGG - Intergenic
1010767814 6:79796259-79796281 GTTGAGAAAACAGCAGAAGCAGG + Intergenic
1011902776 6:92321210-92321232 TTTGTGAAAACAGCAGAAGCAGG + Intergenic
1012020689 6:93915308-93915330 GTTGTCAAAGCACCATAATTTGG - Intergenic
1013730362 6:113157372-113157394 GCTGGCAAACCACCAGAACTAGG - Intergenic
1013731585 6:113174241-113174263 GGGGTCAAAACACCAGGAGCAGG + Intergenic
1018435141 6:163752493-163752515 GTTGCCACACCACCAGAGACTGG + Intergenic
1019438411 7:1033623-1033645 GTGGTCAAACCAACTGATGCAGG + Intronic
1020195909 7:6038908-6038930 GTTGTAATACCAGCAGAAGGGGG + Intronic
1022180808 7:27917503-27917525 GTTCTCAAACCAACAGCATCAGG - Intronic
1022538152 7:31110971-31110993 TTTGTAAAACCACCAGCATCAGG + Exonic
1023622198 7:42085342-42085364 GTTGCAAAACTAGCAGAAGCAGG + Intronic
1025950426 7:66141121-66141143 GTTGTCCAACAGCCAGAAGAGGG + Intronic
1026766878 7:73165706-73165728 CTTTTAAAACCACCAGCAGCTGG - Intergenic
1027043356 7:74975405-74975427 CTTTTAAAACCACCAGCAGCTGG - Intronic
1027080291 7:75226954-75226976 CTTTTAAAACCACCAGCAGCTGG + Intergenic
1028366715 7:90040690-90040712 GTCGTAGAGCCACCAGAAGCTGG - Intergenic
1029389498 7:100265560-100265582 CTTTTAAAACCACCAGCAGCTGG + Intronic
1031793654 7:126142619-126142641 TTTGTGAAAACAGCAGAAGCAGG - Intergenic
1032386393 7:131528459-131528481 GTTGTGAAAACACCAGCAGCTGG + Intronic
1035678929 8:1473439-1473461 GTTGTAAAACAACCAGAAAATGG + Intergenic
1035704060 8:1661372-1661394 GTTGACAAAAGGCCAGAAGCTGG + Intronic
1036158741 8:6366869-6366891 TTTGTCAAAACACAAGAAACTGG - Intergenic
1040011167 8:42662192-42662214 CCCTTCAAACCACCAGAAGCTGG - Intergenic
1044369626 8:91393668-91393690 GAAGTCAAACCACCAGAGGGAGG - Intronic
1047733019 8:127741854-127741876 GTTGTGAAGGCAGCAGAAGCTGG - Intergenic
1050977606 9:11961379-11961401 TTTGTTAAAGCACCAGAAGTAGG - Intergenic
1051337538 9:16079574-16079596 GTCCGCAAATCACCAGAAGCCGG + Intergenic
1051724940 9:20079163-20079185 GTTATGCAGCCACCAGAAGCTGG + Intergenic
1051745720 9:20292989-20293011 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1052270856 9:26626578-26626600 GTAGCAAAAGCACCAGAAGCAGG + Intergenic
1053487769 9:38472985-38473007 AGTGTCAAACTACCATAAGCAGG - Intergenic
1054323236 9:63695050-63695072 GTGGTGCAACCCCCAGAAGCTGG + Intergenic
1056548058 9:87629321-87629343 GCTGGCAAAGCCCCAGAAGCTGG + Intronic
1059202829 9:112434011-112434033 GTTGTGAAACAACTAGAGGCCGG - Intronic
1062402024 9:136376932-136376954 CCTGAGAAACCACCAGAAGCAGG - Intronic
1188457470 X:30383030-30383052 GCCAACAAACCACCAGAAGCTGG + Intergenic
1192369816 X:70504042-70504064 GTTGTCCAACCAGCAGAATGAGG + Exonic
1194837179 X:98696036-98696058 GTTTTCAAACAACCAGATCCTGG + Intergenic
1200311010 X:155077364-155077386 CTTGTGAAACCACCTAAAGCAGG - Intronic
1201896826 Y:19000528-19000550 CTTGTCACACATCCAGAAGCTGG + Intergenic