ID: 953126751

View in Genome Browser
Species Human (GRCh38)
Location 3:40097737-40097759
Sequence ACTTCTGTCTACAGAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953126751_953126754 13 Left 953126751 3:40097737-40097759 CCTGTGTCTCTGTAGACAGAAGT 0: 1
1: 0
2: 8
3: 20
4: 193
Right 953126754 3:40097773-40097795 GAAATGCTGCAGAACCCATTTGG 0: 1
1: 0
2: 0
3: 14
4: 143
953126751_953126755 16 Left 953126751 3:40097737-40097759 CCTGTGTCTCTGTAGACAGAAGT 0: 1
1: 0
2: 8
3: 20
4: 193
Right 953126755 3:40097776-40097798 ATGCTGCAGAACCCATTTGGTGG 0: 1
1: 0
2: 2
3: 9
4: 134
953126751_953126753 -9 Left 953126751 3:40097737-40097759 CCTGTGTCTCTGTAGACAGAAGT 0: 1
1: 0
2: 8
3: 20
4: 193
Right 953126753 3:40097751-40097773 GACAGAAGTCTGCAGAGGCATGG 0: 1
1: 0
2: 5
3: 35
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953126751 Original CRISPR ACTTCTGTCTACAGAGACAC AGG (reversed) Intronic
900227069 1:1538075-1538097 ACTGCTGTCTGCACACACACTGG + Intronic
900416823 1:2539196-2539218 CCTTCTGTCTCCACAGTCACGGG - Intergenic
900569896 1:3353050-3353072 ACTTCTGGCTCCAGAGCCCCAGG - Intronic
904050555 1:27635553-27635575 ACTGCTGTCACCAGAGCCACTGG + Intergenic
904863418 1:33557722-33557744 ACATCTACTTACAGAGACACTGG + Exonic
909138804 1:71836318-71836340 AATTCTGTCTACAGGCACCCGGG - Intronic
909144608 1:71914268-71914290 AATTCTGTCTATAGAGAAGCTGG - Intronic
910281129 1:85502830-85502852 ACCTCTGTCTGCAGAGCCATGGG + Intronic
910933593 1:92466619-92466641 ACTTCAGTCTCCCGAGTCACTGG + Intergenic
911662885 1:100523398-100523420 ACATCTGTTAGCAGAGACACTGG + Intergenic
917634424 1:176920924-176920946 ATTGCTGTCTGCAGAGTCACTGG - Intronic
920055920 1:203191594-203191616 ACTTCTGTCTACAGACCCCCTGG + Intergenic
921278957 1:213546483-213546505 ACATCTATCTACAGATACATTGG - Intergenic
1062831304 10:607748-607770 GCTTCTGTCTTCAGAGACAATGG + Intronic
1063225967 10:4015176-4015198 ACTTCTATCTTCAGAGTTACCGG + Intergenic
1064963390 10:20991047-20991069 GCTTTTCTCTACAGGGACACAGG + Intronic
1065094110 10:22263777-22263799 ACTTCTGCCTCCTGAGTCACTGG + Intergenic
1065829147 10:29598543-29598565 ATTTCTGTCCACAGGGGCACAGG - Intronic
1065900532 10:30203545-30203567 TCTTCTGCCTACAGAACCACAGG + Intergenic
1067158078 10:43799586-43799608 ACTTCCGTGTCCAGAGGCACTGG + Intergenic
1067733943 10:48834604-48834626 CCTTCTGTCTCAAGTGACACTGG - Intronic
1068551615 10:58413883-58413905 ACTTCTGTGAACATAGACCCTGG + Intergenic
1070787397 10:79169937-79169959 ACTTCCCTCTCCAGAGACAATGG + Intronic
1071051692 10:81458457-81458479 ACCTCTGTCTACAGAGCTAAGGG + Intergenic
1072759690 10:98046238-98046260 ACTTCTGTCCACAGAGATAAGGG + Intergenic
1072865170 10:99051775-99051797 ACTACTTTCTGCAGACACACTGG - Intronic
1073677204 10:105661651-105661673 ACATATGTCTACAAAGACAAGGG + Intergenic
1074401465 10:113144288-113144310 ACCTCTGTCCACAGAGCCTCTGG - Intronic
1077343110 11:2034802-2034824 GCCTCTGTCTACAGGGCCACTGG + Intergenic
1077838442 11:5945999-5946021 ATTTCTGTCTACTGGGACAGAGG - Intergenic
1079946900 11:26754773-26754795 AATTCTGTTTATAGAGACATGGG - Intergenic
1083367024 11:62147554-62147576 ACTTCTGTGCACACAGACACAGG - Intronic
1083469508 11:62873644-62873666 ACTTTTTTTTATAGAGACACGGG + Intronic
1084590106 11:70085462-70085484 ACTTCTCTCTACAGTAACACAGG - Intronic
1084676516 11:70638550-70638572 TCTTCTGTCAACAGATGCACCGG + Intronic
1086051605 11:82598457-82598479 ACTTCAGTCTACTGAGAGCCAGG + Intergenic
1086434793 11:86770573-86770595 ACTTCTTTCTACACAGACACAGG + Intergenic
1088544357 11:110944977-110944999 AATTCTGTCTAGAGAGGCAGGGG - Intergenic
1088819553 11:113445908-113445930 ACTGCTGGCTACAGAGATGCTGG + Intronic
1091122841 11:133070916-133070938 CCTTCAGTCTTCTGAGACACAGG + Intronic
1202826096 11_KI270721v1_random:89991-90013 GCCTCTGTCTACAGGGCCACTGG + Intergenic
1091444909 12:539113-539135 ACTTCTGGCCTCAGAGACCCTGG - Intronic
1092521733 12:9282571-9282593 AATTCTATTTACAGAAACACTGG + Intergenic
1092926729 12:13278660-13278682 ACTGCTGTCCACAGACTCACAGG - Intergenic
1099849631 12:88075665-88075687 AATTCTGTTTACAGAGAAAAGGG + Intronic
1100705285 12:97194173-97194195 AATCCTGTCTACAGAAACAATGG + Intergenic
1102898746 12:116619750-116619772 ACTTCATCCGACAGAGACACTGG + Intergenic
1104058269 12:125246755-125246777 ACTTCTGTCCACAGGAACAAAGG - Intronic
1106303427 13:28489733-28489755 ACTTCTCTCCACACACACACTGG - Intronic
1106949986 13:34872631-34872653 ACTGCTGTCTCCAGAGTCACTGG - Intergenic
1108535533 13:51372677-51372699 ACGTATGTCTTGAGAGACACTGG - Intronic
1109657965 13:65419672-65419694 ACTTCTGTCTCCTGAGTAACTGG + Intergenic
1111388666 13:87562024-87562046 ACTTCTTTCTACACAGACACCGG - Intergenic
1111398045 13:87693567-87693589 ACCTCTAGCTACAGAGTCACAGG + Exonic
1111421900 13:88022034-88022056 ACTTCTGTATTAAGAAACACAGG - Intergenic
1111973809 13:94944954-94944976 ACCTCTGTCTAGAGAGGCTCAGG - Intergenic
1112937817 13:104823169-104823191 ACTTTTCTCTATTGAGACACAGG + Intergenic
1113888392 13:113723763-113723785 ACGTGTGTGCACAGAGACACAGG - Intronic
1114336734 14:21698176-21698198 ACTTCTTTCCACACAGACACAGG - Intergenic
1114594201 14:23898089-23898111 ACTTCCCTCTACACAGACACAGG + Intergenic
1115746741 14:36445611-36445633 AGTTCTGTCTACAAACCCACAGG + Intergenic
1116328364 14:43563485-43563507 TCTTCTGTCTAGAGACACTCAGG - Intergenic
1117126717 14:52636381-52636403 ACTTCTTTCCATATAGACACTGG - Exonic
1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG + Intergenic
1119268971 14:73284482-73284504 ACTTATGTTTTAAGAGACACTGG - Intronic
1120344688 14:83270955-83270977 ATGTCTGTCTTCAGAGACAATGG + Intergenic
1121601651 14:95209474-95209496 ATGTCTGTCGAGAGAGACACAGG + Exonic
1122977678 14:105177629-105177651 ACTGATGTCTACGGGGACACTGG - Intronic
1124256391 15:28146177-28146199 GGTTGTGTCTACGGAGACACAGG + Intronic
1125337383 15:38639995-38640017 AGTTCTGTGTACAGAGTAACAGG - Intergenic
1125909064 15:43420185-43420207 ATTTCTGACTTTAGAGACACTGG + Intronic
1126372535 15:47962410-47962432 ACTTCTGTCTAATGAGAATCAGG - Intergenic
1128391624 15:67186440-67186462 CCTTCATTATACAGAGACACAGG + Intronic
1129203871 15:74023765-74023787 ACTTCTCTGTTCCGAGACACCGG - Intronic
1132534690 16:472282-472304 ACTTCTGCCCACACAGACCCTGG + Intronic
1134136869 16:11682529-11682551 GCATCTGTGTAGAGAGACACAGG - Intronic
1134423125 16:14112825-14112847 ACTTCTGTCCATGGAGACACTGG - Intronic
1134846528 16:17445516-17445538 ACATCTGTCTAGAGAGGCCCCGG + Intronic
1137553065 16:49453617-49453639 ACCTCTGTCAGCAGAGACAAGGG - Intergenic
1139000164 16:62499819-62499841 ACTTCTATTTACACACACACAGG + Intergenic
1139243581 16:65419246-65419268 CCTTGGGTCTACAGAGACCCAGG - Intergenic
1140207187 16:72942997-72943019 AATACTGTCTTCGGAGACACTGG - Intronic
1141260751 16:82451644-82451666 AACTCTGTCCACTGAGACACGGG - Intergenic
1143964259 17:10745354-10745376 GCTTCTGTCCACACATACACAGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144440850 17:15279892-15279914 ATTTCTGTCTCAACAGACACCGG + Intergenic
1144816910 17:18040766-18040788 ACTTTTCTCTACACAGGCACAGG + Intronic
1146470957 17:33124569-33124591 GCTTTTTACTACAGAGACACTGG - Intronic
1147181711 17:38690736-38690758 ACTTCAGTCAAAAGAGACAGAGG - Intergenic
1149206715 17:54256244-54256266 ACTTTTTTCTCCAGAGACACAGG + Intergenic
1150755960 17:67913883-67913905 GCCTGTGGCTACAGAGACACAGG + Intronic
1154003350 18:10505828-10505850 ACTTCTTTCTACACAGACACAGG + Intergenic
1156841237 18:41612173-41612195 AGTTGTGCCTGCAGAGACACAGG + Intergenic
1157092720 18:44654933-44654955 GCTTTTGTTTGCAGAGACACAGG - Intergenic
1157363519 18:47041671-47041693 ACTTATGTTCACAGAGAAACTGG - Intronic
1157679325 18:49591544-49591566 ACATCTGTGTACACAGAAACCGG + Exonic
1160527663 18:79546924-79546946 GCTTCTGTCTCCGCAGACACGGG - Intergenic
1161609876 19:5236637-5236659 AATCCTGTCCTCAGAGACACTGG + Intronic
1163134064 19:15296569-15296591 ACTGCTCTCTAAAGACACACTGG - Intronic
1168511958 19:56980123-56980145 GCTTCCGTCTACTGAGACAGGGG + Intergenic
926291360 2:11533525-11533547 GCTTCTGTTTACAGAGTCTCAGG - Intergenic
927505372 2:23609942-23609964 ACTACTGTCTTCAGTGACATGGG + Intronic
929976115 2:46636677-46636699 GCTTCTTTCAACAGCGACACTGG - Intergenic
930435467 2:51335549-51335571 ACTTTTGAGTACAGAGATACAGG + Intergenic
930889289 2:56364189-56364211 CACTCTGGCTACAGAGACACTGG + Intronic
932695300 2:73951288-73951310 ACTTCTATCTCCAGAGACTCTGG - Intronic
935427934 2:102940589-102940611 GCATCTCTCCACAGAGACACTGG + Intergenic
940007593 2:149022136-149022158 ACCTCTTTCTACAGAGAGTCTGG + Intronic
940170089 2:150819469-150819491 TATTCTGTCTACAGAAACAATGG - Intergenic
942672276 2:178388747-178388769 ACTTCTGTCTCCAGAAAAGCAGG + Intronic
943396677 2:187346105-187346127 TCTTCTGGCTACAGAGTCATGGG + Exonic
943446801 2:187996164-187996186 ATTTCTTTCAGCAGAGACACAGG + Intergenic
1169118026 20:3079193-3079215 GCTTCTGTCCACAGAGTAACTGG + Intergenic
1172096915 20:32465017-32465039 ATTTCTCTCTGCAGAGACCCTGG + Intronic
1173419272 20:42886509-42886531 ACTGCTTTTTACAGAGAAACAGG - Intronic
1173706580 20:45114667-45114689 ACACATGTCTACACAGACACAGG + Intronic
1175739339 20:61409669-61409691 AAATCAGTCTACAGAGATACCGG + Intronic
1179443033 21:41408973-41408995 GCTTCAGTCTCCAGAGTCACTGG - Intronic
1179517101 21:41916012-41916034 ACTAATGTCTCAAGAGACACAGG + Intronic
1179921487 21:44509987-44510009 GCTTCTGTCTACAGAGCCAGAGG - Intronic
1179922369 21:44514067-44514089 ACTTCTGTCTTCTCTGACACAGG - Intronic
1180748398 22:18108175-18108197 ATTTCTGACTACAGTCACACTGG + Intronic
1182034739 22:27189053-27189075 ACTTTTGTGTGCAGAGAAACAGG + Intergenic
1182860944 22:33558828-33558850 AGTTCTGTCCACAGAGCCATTGG - Intronic
1184464372 22:44660260-44660282 ACTCCTGTTTGCTGAGACACAGG + Intergenic
951575734 3:24111870-24111892 TCACCAGTCTACAGAGACACTGG - Intergenic
953042186 3:39265405-39265427 CCTTGTGTCTACAGAGAACCTGG - Exonic
953076589 3:39577503-39577525 ACTCCCCTGTACAGAGACACAGG + Intergenic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
953295724 3:41713759-41713781 AATTCTGTGTTCAGAGACAAGGG - Intronic
953736955 3:45503232-45503254 ACTTCTGTCTACAGATTCTCAGG + Intronic
954654392 3:52185189-52185211 TCTTCTGTCTGCTAAGACACAGG + Intergenic
954668328 3:52272892-52272914 ACTTCTCACTACAAATACACTGG + Intronic
955760082 3:62270880-62270902 ACTTCTGTCTTTAGAGTCAGAGG - Intronic
956364362 3:68483819-68483841 ACTTCGGGCTCCAGTGACACTGG - Intronic
958050849 3:88343424-88343446 ATTTCTGTCAACAGACTCACTGG - Intergenic
959902273 3:111674491-111674513 GCGTCTGTCTACACACACACTGG + Intergenic
960322064 3:116248788-116248810 ACATCAGTCTACACAGACATGGG - Intronic
961353768 3:126321107-126321129 ACATCTGGCTACACAGGCACAGG + Intergenic
961435208 3:126912111-126912133 ACTTCTCTCAACAGCAACACAGG - Intronic
962437249 3:135378512-135378534 GCTTCAGTCTACAGAGTAACTGG - Intergenic
964594686 3:158411630-158411652 ACCTCAGCCTCCAGAGACACTGG + Intronic
966620857 3:181962777-181962799 ACTTCTGTCCCCAGTGTCACTGG - Intergenic
968227152 3:196979932-196979954 CCTTCTGGCTAGAAAGACACAGG - Intergenic
969491494 4:7501685-7501707 CCTTCAGTCTCCAGACACACAGG - Intronic
970859285 4:20683223-20683245 AATGCTGTCTACAGAGACCCAGG + Intergenic
976201512 4:82584095-82584117 ACTTCTGTTTACAAAGAAATGGG - Intergenic
977077488 4:92474517-92474539 ACTTCTGTGTACAAATACAAAGG - Intronic
980305038 4:131049839-131049861 AATTCTGTCAAAAGAAACACAGG - Intergenic
980893116 4:138836017-138836039 ACTTTTGTTTCCAGAGGCACAGG + Intergenic
981649298 4:147037954-147037976 GCTTCTCTGTACAGAGCCACTGG - Intergenic
983519683 4:168694763-168694785 ACTTCTGTCTAGACAGAGAGGGG - Intronic
983756773 4:171348303-171348325 ACTTCTGTCTGCAGATAGAATGG + Intergenic
984081769 4:175255781-175255803 ACTTCAGCCTCCAGAGTCACTGG + Intergenic
985118956 4:186620254-186620276 ACTGCTGTAGACAGAGACAGTGG - Exonic
985574229 5:666116-666138 ACTTCCCTCTACAGGGGCACAGG + Exonic
985760314 5:1745553-1745575 CCTGCTGTCTGCAGAGGCACCGG - Intergenic
986134272 5:4959594-4959616 AGTTCTGTCTTCTGAGACCCAGG - Intergenic
988174362 5:27702320-27702342 ACCTCAGTCTCCAGAGAAACTGG + Intergenic
991995368 5:72381191-72381213 ACTTCTTTCTACACAGTCAAGGG - Intergenic
994420714 5:99524877-99524899 AGTTCTGTCTGCAGAGGCCCGGG + Intergenic
994486329 5:100389437-100389459 AGTTCTGTCTGCAGAGGCCCGGG - Intergenic
997604124 5:135161818-135161840 CCTTCTGTCTTCAAAGCCACTGG + Intronic
998737545 5:145159773-145159795 ACTTCTGTCTACATAGGCGGTGG + Intergenic
1005464207 6:26095924-26095946 AGTTCTGACTCCAGAGGCACTGG - Exonic
1006895130 6:37463290-37463312 ACTCCTGCCTCCAGGGACACAGG - Intronic
1008213412 6:48754561-48754583 ACTTCTGTCTACTCATACATAGG - Intergenic
1008214898 6:48777305-48777327 ACTACTGTCTACATAGAAAAAGG + Intergenic
1010871696 6:81050002-81050024 GCTTCTGTCTACTAAGGCACTGG + Intergenic
1011044773 6:83068659-83068681 ACTTATGTCTGCATAGACAATGG - Intronic
1011582958 6:88891449-88891471 ACTTCTGATTACAGAAAAACTGG + Intronic
1013774114 6:113660199-113660221 ACCTCTTTCTACAGAGACTGAGG - Intergenic
1014086086 6:117345717-117345739 TCTTCTGTAAACAGAGACAATGG + Intronic
1014826656 6:126054831-126054853 TCTGCTGTCTTCTGAGACACAGG + Intergenic
1014991409 6:128082826-128082848 TCATCTATCTACAGATACACCGG + Intronic
1016800873 6:148167815-148167837 CCTTATGTCTACAGAGAAACTGG - Intergenic
1017282996 6:152643396-152643418 ACTTCTAGCTCCAGAGATACAGG + Intergenic
1018502674 6:164428256-164428278 ACTTCTGTCAGCAGAGAGGCTGG + Intergenic
1019128271 6:169856325-169856347 ACTTCTTTCTACACAGACACAGG + Intergenic
1022542796 7:31153832-31153854 ACTTCTTTCTACACAGACACAGG - Intergenic
1024580285 7:50795368-50795390 ACTGATGTCTACAGAGAGCCAGG - Intergenic
1024811151 7:53213736-53213758 ACTTTTCTCTGCAGAGAAACTGG - Intergenic
1025201125 7:56962413-56962435 ACTCCTGTCTGCAGAGTCCCAGG - Intergenic
1025670819 7:63614519-63614541 ACTCCTGTCTGCAGAGTCCCAGG + Intergenic
1031202296 7:118703574-118703596 GCATCTTTCTCCAGAGACACTGG + Intergenic
1033185929 7:139226563-139226585 ACTTCTTTCTACACAGACACAGG - Intergenic
1033545052 7:142392097-142392119 ACTTTTGTCTTCTGACACACAGG + Intergenic
1034176355 7:149103191-149103213 AATACTGGCTACAGACACACTGG - Exonic
1034428376 7:151027045-151027067 ACTTCTTTCTACACAGACACAGG - Intergenic
1035256893 7:157635052-157635074 TCTCCTGTCCACAGCGACACGGG + Intronic
1037386897 8:18352461-18352483 ACTTCTGTCAACAAACACACTGG - Intergenic
1038131829 8:24740787-24740809 TCTGCTGTCTAGAGAAACACCGG + Intergenic
1038350345 8:26770499-26770521 ACTGCTTTCTGCAGAGACACTGG + Exonic
1040043295 8:42939112-42939134 ACCTCTTTCTACACAGACAACGG + Intronic
1043427743 8:80165336-80165358 AATTCTTCCTACAGACACACTGG + Intronic
1043766783 8:84145024-84145046 ATTTCTGTCTTCACAGACAAGGG + Intergenic
1044466461 8:92512515-92512537 ATATCTGTCTACAGAGAAGCTGG - Intergenic
1044539759 8:93395359-93395381 ACTTCTGTCATAAAAGACACAGG + Intergenic
1044871215 8:96621697-96621719 TCTTCTATCTAGAGGGACACTGG + Intergenic
1046090645 8:109499357-109499379 ACTACTTTCTTCAGAGACACTGG - Intronic
1046294636 8:112201773-112201795 AATTCTATCTCCAAAGACACCGG - Intergenic
1046418113 8:113941560-113941582 ACTTCTGCAAACAGAAACACAGG - Intergenic
1046540516 8:115575432-115575454 ACTTCTGGACACAGACACACAGG - Intronic
1050305896 9:4305706-4305728 TCTTCTTTCTAGAGAGCCACTGG + Intronic
1052888026 9:33667958-33667980 ACTTCTTTCTACACAGACACAGG - Intergenic
1056010105 9:82320040-82320062 AATTCTGTCTATTGAGAGACAGG + Intergenic
1057670755 9:97086095-97086117 ACCTCTGTGTAATGAGACACAGG - Intergenic
1057798936 9:98177579-98177601 GCTTCAGTCTCCAGAGAAACTGG + Intronic
1059343539 9:113613061-113613083 TTTCCTGTCTGCAGAGACACAGG - Intergenic
1061441121 9:130604301-130604323 ACTTACTTCTTCAGAGACACTGG - Intronic
1061585914 9:131568263-131568285 AGTTCTGTCAATAGAGACGCTGG - Intergenic
1062069529 9:134548062-134548084 ATTGCTGTCCCCAGAGACACAGG - Intergenic
1187355781 X:18570048-18570070 TCTTCTGTTTACCCAGACACTGG + Intronic
1189192510 X:39122728-39122750 GCTTCTGTTGTCAGAGACACAGG - Intergenic
1191079009 X:56488649-56488671 ACATCTGGCTACAGAAACACTGG - Intergenic
1193133631 X:77945591-77945613 ACATGTGTCTACAGGGACTCTGG - Intronic
1193232131 X:79059679-79059701 AATACTGCTTACAGAGACACAGG - Intergenic
1197159733 X:123309757-123309779 ACTTGTTTCTACACAGCCACTGG - Intronic
1199359427 X:146901384-146901406 TCTTATGCCTACAGAGACAATGG + Intergenic
1199571219 X:149269037-149269059 GATTCTGTCTTCAGAGAAACTGG + Intergenic
1201452845 Y:14135097-14135119 TCTTCTGTGTTCAGAGACAGGGG - Intergenic
1201586847 Y:15570371-15570393 ACTCCAGTCTTTAGAGACACTGG - Intergenic