ID: 953126810

View in Genome Browser
Species Human (GRCh38)
Location 3:40098404-40098426
Sequence TACCCACAGCTGCTACCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953126810 Original CRISPR TACCCACAGCTGCTACCAAA GGG (reversed) Intronic
904433253 1:30478798-30478820 TAACCACAGCTGCCCCCACAGGG - Intergenic
905852236 1:41282905-41282927 TCCCAGCAGCTGCTGCCAAAGGG + Intergenic
906957519 1:50387500-50387522 TACCCAGACCTTCTACCCAAAGG - Intergenic
909625261 1:77708319-77708341 TGCCCAAAGCTGCCACCAGAGGG - Intronic
912416094 1:109509296-109509318 TTCCCTCAGCTCCTCCCAAAAGG - Intronic
913495774 1:119426872-119426894 AACCCAGAGCTCCTACAAAAGGG - Intergenic
913985784 1:143564862-143564884 TATCCTCACATGCTACCAAAAGG + Intergenic
917913760 1:179678998-179679020 TACCAACAGCATCTACAAAAAGG - Intronic
920778162 1:208961220-208961242 TACCCACAGCTGTCACTGAATGG + Intergenic
921874305 1:220176859-220176881 TTCCCACAGCTGATCCCAAGAGG + Intronic
922315095 1:224434777-224434799 TTCCCCCAGCTGCTGCCTAATGG + Intronic
922641872 1:227241658-227241680 TCCCCACAGCTTCCATCAAATGG - Intronic
1067286729 10:44912491-44912513 TACCCACGGGTCTTACCAAATGG + Intronic
1070939118 10:80327677-80327699 TAATCACAGTAGCTACCAAAGGG + Intergenic
1071575062 10:86719043-86719065 TCCCCAAAGCTGCAACCATATGG - Intronic
1071723992 10:88177932-88177954 TGCCCACATGTGCTACCTAAAGG - Intergenic
1073763544 10:106656771-106656793 TACCCCCAGCTAATTCCAAAGGG - Intronic
1074180071 10:111053101-111053123 TACACAGAGCTGCTACCTATAGG - Intergenic
1075507688 10:123039388-123039410 AACCCACAGCTGCTAACAGAAGG - Intronic
1075869580 10:125760175-125760197 TACCCACTGCTGTTAGAAAAAGG - Intronic
1081590347 11:44418558-44418580 TCACCACAGCTGTTACCAAGTGG + Intergenic
1082984908 11:59160125-59160147 TTCCCACATCTGATACCAGAGGG - Intergenic
1083124067 11:60545436-60545458 TTCTCACAGCAGCTCCCAAAAGG + Intergenic
1087821772 11:102720442-102720464 TACACACAGCTCCTAGCATATGG + Intronic
1088883632 11:113990547-113990569 TTCCCAAAGCTGCTGACAAATGG - Intergenic
1090593535 11:128296358-128296380 TACCCAGCTCTGCTACCAGAAGG - Intergenic
1091215522 11:133899110-133899132 TACCTCCACCTTCTACCAAAGGG + Intergenic
1092037971 12:5357148-5357170 TTCCCAGCGCTGTTACCAAATGG + Intergenic
1092833130 12:12464337-12464359 TCCCCACAGATGATAGCAAAAGG + Intronic
1093243945 12:16712375-16712397 TACCCACAGAAGGTGCCAAAAGG + Intergenic
1093460715 12:19404465-19404487 TACCCACTGCTTCTTTCAAAGGG + Intronic
1093709528 12:22314132-22314154 TACAAACAGCTGCTGCAAAATGG + Intronic
1093726213 12:22512048-22512070 AACCTACAACTGCCACCAAAAGG - Intronic
1097053752 12:56238398-56238420 TGCCCACAGCGGGTACCAGACGG + Exonic
1097661872 12:62438862-62438884 CACTCACAGCTGCTACAATAGGG + Intergenic
1097987517 12:65799520-65799542 TACACATATCTGCTACCCAAAGG - Intergenic
1102315729 12:111885866-111885888 CATGCACAGTTGCTACCAAAAGG - Intronic
1102948401 12:117010685-117010707 TACCAACTGCGGCCACCAAATGG - Intronic
1105540151 13:21309253-21309275 TACCCAAAGCTTCAGCCAAAAGG - Intergenic
1105817333 13:24049019-24049041 TAGACACAGGGGCTACCAAATGG + Intronic
1108407014 13:50114615-50114637 TATCCACATCTGCTTACAAAGGG + Intronic
1110825502 13:79967181-79967203 TAACCACACCTGCAACCACAGGG + Intergenic
1111858572 13:93671687-93671709 TCACCACAGCGGGTACCAAATGG + Intronic
1117483566 14:56172188-56172210 TAACCTCAGCTGATACCATATGG - Intronic
1118045506 14:61966931-61966953 TACTCTCAGCAGCTAGCAAAAGG - Intergenic
1123920586 15:25067018-25067040 TCCCCACACCTGCAACCAAAAGG - Intergenic
1125281389 15:38045418-38045440 TCCCTACAGCTTCTGCCAAATGG + Intergenic
1125380150 15:39078882-39078904 TACCCACACGTGCTACAACATGG + Intergenic
1125739183 15:41949989-41950011 TCCCCAGAGCTGCTCCCAGATGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127059016 15:55163084-55163106 TACACTAGGCTGCTACCAAATGG + Intergenic
1128843514 15:70870456-70870478 TACCTACTGCTTATACCAAATGG - Intronic
1129691604 15:77717112-77717134 TGCCCACAGCTGCCACCCAGAGG + Intronic
1132087792 15:98922352-98922374 TATCCACAGCTGCAACCACGAGG + Exonic
1134155517 16:11839726-11839748 ATCCCACAGCTGGTACCAATAGG - Exonic
1135628733 16:24018962-24018984 TGCCCACAACTGCAAACAAAAGG - Intronic
1139679481 16:68549950-68549972 TACCCAAAGCTTCTGCCACATGG - Intronic
1141823132 16:86461427-86461449 TTCCCAGAGCAGGTACCAAAAGG - Intergenic
1143066947 17:4257233-4257255 GCCCCACAGCCTCTACCAAATGG + Intronic
1153514130 18:5889777-5889799 TGCCCACAGCTGCTTGCGAATGG - Exonic
1157120135 18:44901527-44901549 TACCCAAAGCTTCAGCCAAAAGG - Intronic
1157247357 18:46066445-46066467 AGCCCACAGCAGCTACCACAAGG + Intronic
1157274441 18:46301010-46301032 TACCCACTGCCTCTACCAAAAGG + Intergenic
1161258853 19:3324565-3324587 TCCCCACAGCAGCCACCAGAGGG + Intergenic
1161431240 19:4233525-4233547 TTCCCACAGCAGCCACCAGAGGG + Intronic
1161493684 19:4576165-4576187 TCCCCAAAGCTGCCACCAGAGGG + Intergenic
1161541059 19:4851794-4851816 TCCCCACAGCAGCCACCAGAGGG - Intronic
1163730908 19:18948708-18948730 TTCCCACAGCTGCTCCCCCAAGG - Intergenic
1167881642 19:52463850-52463872 TAGTCACAGCTTCTTCCAAAGGG + Intronic
928264955 2:29803266-29803288 TGCCCACATCTGCTGCCTAATGG - Intronic
933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG + Intergenic
936818174 2:116485177-116485199 GGCCCACTGCTGCTACCACAGGG + Intergenic
941858588 2:170254833-170254855 TAGCCACAGCTTCTACCTGAGGG + Intronic
941897185 2:170641033-170641055 TACCCACACCTGTTAGCCAACGG + Intronic
944774165 2:202945260-202945282 TATCAACATCTCCTACCAAATGG + Intronic
948406453 2:237723862-237723884 TATGCACAGCTGCTAACACAAGG - Intronic
1172076104 20:32298782-32298804 TACCTACAGCTACTCCAAAAAGG - Intronic
1173428746 20:42967166-42967188 AACCCACTGCAGCTACCAAAGGG - Intronic
1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG + Intergenic
1175198113 20:57259984-57260006 AACACACAGCTAATACCAAACGG + Intronic
1178242761 21:30921723-30921745 TTCCCCCAACTGTTACCAAATGG - Intergenic
1179408208 21:41142613-41142635 AGCCCACAGCTGGAACCAAAAGG - Intergenic
1180001550 21:44997576-44997598 CACACACAGCTGCTACCACTCGG - Intergenic
1183222186 22:36522497-36522519 TACCGACACATGCTACCACATGG + Intronic
1184348174 22:43925592-43925614 TGCCCACTGCTCCTACCCAATGG - Intronic
1184458605 22:44625059-44625081 TACCCTGAGCTGCTGCCCAAGGG + Intergenic
949811658 3:8012864-8012886 CACCCACTGCTGCTCCCAATAGG - Intergenic
950533470 3:13566488-13566510 TCTCCACAGCTGCTCCCAATGGG - Intronic
953126810 3:40098404-40098426 TACCCACAGCTGCTACCAAAGGG - Intronic
954471748 3:50702956-50702978 AACCCACAGCTGACACCATACGG - Intronic
961594269 3:128004836-128004858 TACACACAGCTGCTGCCGGAGGG + Intergenic
962293650 3:134160036-134160058 TACACAGAGCTGCTGCCACATGG + Intronic
964841083 3:160994353-160994375 GAACCACAGCTGCTTGCAAAAGG + Intronic
966856229 3:184195704-184195726 TAACCACAGCTGGTAGCAGAAGG + Intronic
966925525 3:184642440-184642462 TACCTACAGCTGCTTACAACTGG - Intronic
972172694 4:36366138-36366160 TTCCCACTGATGCTTCCAAATGG - Intergenic
975252978 4:72200782-72200804 TATCCAGTTCTGCTACCAAATGG - Intergenic
977060923 4:92256160-92256182 TACCCACTGCTGCCACCATGGGG - Intergenic
982612472 4:157593339-157593361 TACCCACAGCCCCAACCAAGTGG + Intergenic
987504959 5:18755973-18755995 TCTCCCCTGCTGCTACCAAAAGG + Intergenic
990303248 5:54470197-54470219 TAGCCACAGCTGCCACCGATGGG - Intergenic
993246396 5:85458707-85458729 GACACAAAGCTGCTACCAATGGG + Intergenic
1001116669 5:168946357-168946379 CACCCACAGATGCTACCATGGGG + Intronic
1002658686 5:180774449-180774471 TACCTACATCTGGGACCAAAAGG + Intergenic
1003145135 6:3504156-3504178 TGCCCACCGCTGCTACCAAGGGG - Intergenic
1011940411 6:92835809-92835831 CTCTCACAGTTGCTACCAAAAGG - Intergenic
1012710510 6:102597246-102597268 TACCTACTGCTGCTTACAAATGG - Intergenic
1014181890 6:118393386-118393408 TACTGACAGCTGCTACCACATGG - Intergenic
1014693316 6:124588676-124588698 TACTCAGAGGTGCTACCAATTGG + Intronic
1014864395 6:126509916-126509938 TATTCACAATTGCTACCAAATGG + Intergenic
1015343277 6:132126934-132126956 TCCCCACACCTACTGCCAAATGG + Intergenic
1019725893 7:2602536-2602558 CACCCACAGCTGCTTCTAAGTGG + Intronic
1019912464 7:4108983-4109005 CACCCACACCTGCTACCACATGG - Intronic
1022567309 7:31416172-31416194 TACCCTCAGCTTCTAACACATGG + Intergenic
1029551886 7:101240891-101240913 TCCCCAGAGCTGCTGCCCAAAGG - Exonic
1030015455 7:105215668-105215690 TACTCATAGATGCTACCACATGG + Intronic
1030730897 7:112987424-112987446 TTACTACAGCTGCTATCAAAAGG - Intergenic
1030984277 7:116222675-116222697 TCTCCACAGCTGCTTCTAAAGGG - Intronic
1032873383 7:136010845-136010867 TTCCCAAACCTGCTTCCAAAGGG - Intergenic
1037290624 8:17345849-17345871 TTCCCACGTATGCTACCAAAGGG - Intronic
1037665878 8:20969784-20969806 TCCCCACAGCAGCTGCCATATGG + Intergenic
1037996537 8:23356596-23356618 TACTTTCAGCGGCTACCAAAGGG + Intronic
1043114525 8:76233587-76233609 TTGCCCCAGCTGATACCAAATGG + Intergenic
1043516142 8:80996665-80996687 TACCCTCAGCTGCTCCAAGAAGG - Intronic
1045775605 8:105798664-105798686 TACCCACAGTTGGTTTCAAATGG + Intronic
1046565585 8:115895539-115895561 TACCTCCACCTGCTAACAAATGG + Intergenic
1048380650 8:133862237-133862259 TACCCCCATCTCCTCCCAAAAGG - Intergenic
1052518666 9:29514651-29514673 TCCCCACAGATGCTGCCACAGGG - Intergenic
1055120815 9:72658921-72658943 TAGCCACAGATGCTAGCACAAGG + Intronic
1058284030 9:103153494-103153516 CTCCCACAGCAGATACCAAAGGG - Intergenic
1059168787 9:112104644-112104666 TTCTCACAGCTGCTGCCCAAAGG + Intronic
1060052966 9:120390198-120390220 TTCCCACAGCTGCTTCCCAGAGG - Intronic
1060060595 9:120455942-120455964 AACCCACAGCTGCAAGAAAAGGG + Intronic
1060102887 9:120856121-120856143 GCCCCACAGCTGCTGCCACAGGG - Exonic
1060332275 9:122683697-122683719 AACCCACTGCTGCCACCACAGGG + Intergenic
1060690911 9:125659335-125659357 TTCACACAGCTGTTACCAATAGG + Intronic
1189013117 X:37066838-37066860 GACCAACAGCTGATATCAAATGG - Intergenic
1190247307 X:48699123-48699145 TGCCCACATCTGTTTCCAAAGGG + Intronic
1190568359 X:51754847-51754869 TACCCACAGTGGCTAGCACAGGG + Intergenic
1192590993 X:72359291-72359313 TATCCACAGCTCCTAACATAAGG + Intronic
1194339382 X:92690807-92690829 TACACACAGGTGGGACCAAAAGG + Intergenic
1196030702 X:111092926-111092948 TACCCACTTGTGCTCCCAAAAGG + Intronic
1197617316 X:128708522-128708544 TACCCTGTACTGCTACCAAAAGG + Intergenic
1198223279 X:134622424-134622446 TAACCACAGCTGCTTTCAAATGG + Intronic
1199359408 X:146901051-146901073 CATCAACAGCTGCTACTAAATGG - Intergenic
1200647767 Y:5807587-5807609 TACACACAGGTGGGACCAAAAGG + Intergenic
1201399836 Y:13593538-13593560 TCCTCCCAGCTGCTACCAATTGG + Intergenic