ID: 953129371

View in Genome Browser
Species Human (GRCh38)
Location 3:40123758-40123780
Sequence CCTGAGAAGCAGCTCATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953129368_953129371 -7 Left 953129368 3:40123742-40123764 CCTGTAGCTAAGGGACCCTGAGA 0: 1
1: 0
2: 11
3: 37
4: 128
Right 953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG 0: 1
1: 0
2: 5
3: 16
4: 240
953129367_953129371 -4 Left 953129367 3:40123739-40123761 CCACCTGTAGCTAAGGGACCCTG 0: 1
1: 0
2: 1
3: 29
4: 139
Right 953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG 0: 1
1: 0
2: 5
3: 16
4: 240
953129365_953129371 -2 Left 953129365 3:40123737-40123759 CCCCACCTGTAGCTAAGGGACCC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG 0: 1
1: 0
2: 5
3: 16
4: 240
953129366_953129371 -3 Left 953129366 3:40123738-40123760 CCCACCTGTAGCTAAGGGACCCT 0: 1
1: 0
2: 1
3: 5
4: 102
Right 953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG 0: 1
1: 0
2: 5
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953129371 Original CRISPR CCTGAGAAGCAGCTCATCCA AGG Intronic
900195029 1:1371748-1371770 CCTGGGAGGCAGGTCAACCATGG - Intergenic
900309200 1:2025208-2025230 CCTGAGAAGCTGCACCTCCCTGG - Intronic
900837652 1:5018167-5018189 CCTGGGAAGCAGTTTATCTAGGG + Intergenic
904482995 1:30805733-30805755 CCTGAGCACCAGCCCTTCCAGGG - Intergenic
905631088 1:39518942-39518964 CCTTGGAAGCAGCTAATCCCAGG - Intronic
905666673 1:39767234-39767256 CCTTGGAAGCAGCTAATCCCAGG + Intronic
905938552 1:41844193-41844215 ACTGAGAATCAGTTCAGCCAAGG + Intronic
908177790 1:61572867-61572889 CCTGAGAAGCAGCACCTGCATGG + Intergenic
911088302 1:93998018-93998040 CCTGTGGAGCAGTTCTTCCAGGG - Exonic
914251279 1:145924019-145924041 GCTGAGAAACAGTTCATCCATGG - Intergenic
915308074 1:154992627-154992649 CCTGGGAAGGGGCCCATCCATGG - Intronic
916738184 1:167627028-167627050 CCAGAGATACAGCTCAGCCAAGG - Intergenic
917098747 1:171425422-171425444 CCCGAGAAGCTGCTTCTCCATGG - Intergenic
917647223 1:177041110-177041132 ACAGAGAAGCAGCTCATCAAGGG + Intronic
917846160 1:179022222-179022244 CCTGGGAAGCAGCTGAGGCAGGG + Intergenic
920336388 1:205247991-205248013 CCAGGGAAGCAGCTCAGCCTTGG + Intronic
920684617 1:208099932-208099954 CCTGAGAAGCAGCACAGCCATGG + Intronic
922066905 1:222152976-222152998 CCTAAGAAGCAGACCATGCAAGG + Intergenic
922128186 1:222750052-222750074 TCAGTGAAGCACCTCATCCAGGG + Exonic
922235087 1:223716672-223716694 CATGAGACGCAGCTCCTTCAAGG + Intronic
922984481 1:229855515-229855537 CCTGAAAAGTAGATCATCCTTGG - Intergenic
1064672989 10:17734635-17734657 TCTGAGAAACAGCTTATTCACGG - Intergenic
1064680741 10:17808981-17809003 CCTGGGAAGCAGCTGAGTCAGGG - Intergenic
1066059033 10:31706214-31706236 ACTTTGGAGCAGCTCATCCAGGG - Intergenic
1066565058 10:36713117-36713139 TCTGGTAAGCAGCTCAGCCAGGG - Intergenic
1067539552 10:47141836-47141858 GCTGAAAAGCAGCTCATCTGAGG + Intergenic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1068949353 10:62761778-62761800 CCTGAAGGGCAGCTCACCCAAGG - Intergenic
1070356111 10:75642030-75642052 ACTAAGAAGCAGCTCATCCAAGG + Intronic
1071598007 10:86942159-86942181 CCTGAGAAGCAGGTGGGCCAAGG + Intronic
1071908890 10:90207898-90207920 CATGAAAAGCAGCACCTCCATGG - Intergenic
1072895622 10:99364112-99364134 CCTAAGCACCAGCTAATCCAGGG - Intronic
1075400431 10:122157492-122157514 CAACAGAAGCTGCTCATCCATGG + Intronic
1076324651 10:129611755-129611777 AGGGAGAAGCATCTCATCCAAGG - Intronic
1076389194 10:130084794-130084816 CATGGGAAGCAGCTGATTCAGGG + Intergenic
1076630164 10:131847552-131847574 CTTGAGAAGCATCTGAACCATGG + Intergenic
1077578435 11:3401940-3401962 CCTGGGAACCCACTCATCCAGGG + Intergenic
1077751081 11:4970837-4970859 CCTGAGAATCAGCCCATCTAGGG - Intronic
1077868501 11:6241956-6241978 CCTGAGAAGAAGCTGAGCCAAGG + Intronic
1078602566 11:12746819-12746841 CTTCAGCAGCAGCTCATCCTGGG - Intronic
1079844307 11:25445632-25445654 CCTGAGAAGGAGCTCGGCAAGGG + Intergenic
1081935192 11:46899253-46899275 CCTCAGCAGCAGCTCCTCCTAGG - Intronic
1083322822 11:61857653-61857675 CCTGAGAGGCAGCTACCCCAGGG - Intronic
1084235472 11:67785456-67785478 CCTGGGAACCCACTCATCCAGGG + Intergenic
1084672482 11:70615502-70615524 CCTGGAAAGCAGCTCCTCCTGGG - Intronic
1085537645 11:77233274-77233296 CACCAGAAGCAGCTGATCCAGGG + Intronic
1086277308 11:85146584-85146606 CCTGGGTACCAGCTCAGCCACGG - Intronic
1089968308 11:122671992-122672014 CCTGGGAAACAGGTCATGCAGGG + Intronic
1090187824 11:124749783-124749805 ACTGAGATGCAGCTCTTCCGAGG - Exonic
1091033817 11:132215254-132215276 CCTGATCAGCTGTTCATCCAGGG - Intronic
1091160318 11:133413929-133413951 CTGGAGAGGCAGCTCCTCCAGGG - Intronic
1091591748 12:1846616-1846638 CCTGAGAAGCAGCTTGTTCGTGG - Exonic
1091912101 12:4240877-4240899 CCAGAGAAGGAGCTCATGCTGGG - Intergenic
1091941134 12:4483412-4483434 CCTCAGAAGTAGCTGATACAAGG + Intergenic
1092068038 12:5608612-5608634 TCTGAGAAGCAGCTTGCCCATGG + Intronic
1092095629 12:5839716-5839738 CCTGAGCATCATTTCATCCACGG + Intronic
1095238125 12:39823525-39823547 CCAGGGAAGCAGTTCATCTATGG - Intronic
1099674012 12:85733325-85733347 CCTGAGAAGCGGCTGGTGCAAGG - Intergenic
1101456077 12:104832108-104832130 CTTCAGAAGCAGATGATCCATGG + Intronic
1101744910 12:107532164-107532186 CCTGAGGATCAGCTCACCCAGGG + Intronic
1102900641 12:116633865-116633887 GCTGGGAAACAGCTCATCAACGG + Intergenic
1104379087 12:128291409-128291431 CCTCAGTATCAGCCCATCCAGGG - Intronic
1106872402 13:34035991-34036013 CTTCAGATTCAGCTCATCCAAGG + Intergenic
1109212332 13:59548506-59548528 ACTGAGCAGCTGCACATCCAGGG + Intergenic
1113001869 13:105648506-105648528 CCTGGGAACCACCTCAGCCAGGG - Intergenic
1113937710 13:114003173-114003195 CCGGAGGAGAAGCTGATCCAGGG + Intronic
1117022473 14:51585521-51585543 CCTGAGAGGCAGCTGAACCTAGG + Intronic
1117142056 14:52799038-52799060 CCTTGGAAACATCTCATCCACGG + Intergenic
1117889280 14:60400123-60400145 GCTGAGAAACAGTTCATCCATGG + Intronic
1118320563 14:64749870-64749892 CCTGAGGAGCAGCTCAGGCCTGG + Exonic
1119091465 14:71785399-71785421 CCTGAGAACCAGCAAAGCCAAGG - Intergenic
1120027103 14:79598868-79598890 CCTGATAAACAGCTCAGACATGG + Intronic
1120750134 14:88189583-88189605 CCAGATAAGCAGCTCATAAAGGG - Intronic
1121836711 14:97098671-97098693 CCTGAGAAGTGGCCCATCTAGGG + Intergenic
1122129984 14:99599329-99599351 CCTGATAACCTGCTCCTCCACGG - Intronic
1124627455 15:31316556-31316578 CCTGAATGGCTGCTCATCCAAGG + Intergenic
1124687861 15:31797773-31797795 CCGGAGAAGCAGCACACACAGGG - Intronic
1124903873 15:33849771-33849793 ACTGAGAAGCAGCTCTGCAAAGG + Intronic
1127961881 15:63896127-63896149 CAGGGGAAGCAGCTCATCTATGG + Intergenic
1128725070 15:69982247-69982269 CCTGGGGAGCACCTCCTCCATGG - Intergenic
1129181747 15:73882116-73882138 CCCGGGAGGCAGCTCAGCCATGG - Intronic
1129651700 15:77495794-77495816 CCCTAGAAGCCCCTCATCCAAGG + Intergenic
1132601822 16:776202-776224 CCTGAGGAGGAGCCCACCCAGGG + Intronic
1132775889 16:1593817-1593839 ACTGTGAAGCAGCTCTTCCCCGG + Intronic
1133347039 16:5078090-5078112 CCTGGGAACCCACTCATCCAGGG + Intronic
1135907655 16:26528037-26528059 CCTGAGATGCATCTGAACCAGGG - Intergenic
1136116930 16:28100593-28100615 TCTGTGAAGCAGCTTGTCCACGG - Intronic
1137887318 16:52119041-52119063 TCTGAGAAGCTGCCCACCCAGGG + Intergenic
1138738434 16:59279769-59279791 CCAGAGAAGGAGCTCATGCTGGG + Intergenic
1139473051 16:67188552-67188574 CCTATGAGGCAGCTCATCCTGGG - Intronic
1140374588 16:74434524-74434546 CCAGAGAAGCAGCCCAGCCTTGG + Intergenic
1141744508 16:85916480-85916502 GGTGAGAAGCAGCTCACCAAGGG - Intronic
1142007454 16:87696291-87696313 CCTGAGTACCAGCTCTCCCAGGG - Intronic
1142960298 17:3548313-3548335 ATGGAGAAGCAGCTCATCCATGG + Intronic
1143029539 17:3960132-3960154 CCTGAGGAGCAGCAGGTCCAGGG + Intronic
1143410837 17:6707435-6707457 TTTGAGAGGCAGCTAATCCAAGG - Intronic
1146599809 17:34204707-34204729 CCTGACAAGCAGCTCAGCTAGGG + Intergenic
1147411266 17:40254339-40254361 GCTTAGAAGCAGTTCTTCCATGG + Intronic
1149549726 17:57531444-57531466 CCTGAGACCCTGCTCAGCCATGG - Intronic
1151887669 17:76932698-76932720 ACGGAGAAGCGGCTCATCAAAGG + Exonic
1151924244 17:77182430-77182452 CCTGAGAGGAAGCTCCTCCCGGG - Intronic
1152306218 17:79522192-79522214 CCAGAGAACCAGCTCCTCAAAGG - Intergenic
1153962868 18:10154183-10154205 CCTGAGAAGCAACACATTTAAGG + Intergenic
1156228388 18:35130938-35130960 CCTGAGAAGCTGCACAACCCTGG + Intronic
1159041887 18:63332320-63332342 CCTGAGAATAAGCTCATTGAGGG - Intronic
1159956995 18:74525824-74525846 CCTGAGGAGCGGCTCTTCCTCGG - Intergenic
1160123174 18:76148143-76148165 CCTGAGTGGCAGCTCCTACATGG - Intergenic
1160604042 18:80035591-80035613 CCTGGCAAGCACCTCATGCAGGG - Intronic
1161133822 19:2608002-2608024 CCTGAGACGCAGCTCTTTGAGGG + Intronic
1162124818 19:8493761-8493783 CCTGAGAAGCGGGAGATCCAGGG + Intronic
1164438648 19:28254356-28254378 CCTCAAAAGCAGCTGTTCCATGG - Intergenic
1166699861 19:44876053-44876075 CCTGGGAAGAAGCTCCTCCCAGG - Intronic
925819710 2:7788011-7788033 CCTGAGAAGCAAGTCAAGCAAGG - Intergenic
926679987 2:15655614-15655636 CCTGAGAAGCGAGGCATCCACGG - Intergenic
928196190 2:29218309-29218331 CCTGAGAAGTGGCTCTTCCAAGG + Intronic
928358211 2:30640176-30640198 TCAGAGAAGCACCTCCTCCAAGG + Exonic
931044875 2:58340624-58340646 CCAGAGAGGGAGCTCATACAGGG + Intergenic
932715773 2:74100138-74100160 GCTGAGAAGCACCTCATGCGGGG - Intronic
936633062 2:114225634-114225656 CATGAGGAGCAGCTCAGCTAAGG + Intergenic
937220972 2:120343305-120343327 CCTGGGAAGCACCTCCTGCATGG - Intergenic
937880125 2:126858531-126858553 CCTCACAAGTACCTCATCCAAGG - Intergenic
938586658 2:132697229-132697251 CCTGAGGACCAGCTCCTCCAAGG - Intronic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
941722477 2:168826644-168826666 CCTGAGACCCAGCTCCTCCAAGG + Intronic
943455533 2:188102826-188102848 CCAGAGAAGCATATCTTCCAAGG + Intergenic
948083374 2:235226110-235226132 CCTGAGAAGCACATGCTCCAAGG + Intergenic
949025219 2:241764658-241764680 ACTGAGAAGCGGCAGATCCAAGG - Intronic
1169352468 20:4880394-4880416 ACTGAGCACCAGCTCAGCCACGG + Intronic
1170494782 20:16914547-16914569 CATGACAAGCAGGTCCTCCACGG - Intergenic
1171183944 20:23111578-23111600 CCTGAGCAGCAGCCCGTGCAGGG - Intergenic
1171253517 20:23668586-23668608 CCTGAGGGGCTGGTCATCCATGG - Intergenic
1171798030 20:29581601-29581623 ACTGTGAAGCAGTTCCTCCAAGG - Intergenic
1172889390 20:38253169-38253191 TCAGAGAAGGAGCTCATCAAGGG + Intronic
1173158652 20:40636318-40636340 ACTAAGAAGGAGCCCATCCAAGG - Intergenic
1174379830 20:50149390-50149412 CCTGAGAAGTAGCACACACATGG + Intronic
1175316824 20:58054576-58054598 GCTGAGAAGCAGCTGAGCTAGGG + Intergenic
1175321921 20:58094335-58094357 CCCGAGCAGCAGCTCACGCAGGG - Intergenic
1175502449 20:59460138-59460160 CCTCAGCAGGAGCTCAGCCAGGG + Intergenic
1175858956 20:62139289-62139311 CCTGAGAAGGGGCTCAGGCATGG - Intronic
1175927800 20:62479626-62479648 CAGAAGAAGCAGCTCACCCAAGG - Intergenic
1176673678 21:9757384-9757406 CCTGAAAAGCAGCCCACCCTGGG + Intergenic
1177617322 21:23539936-23539958 TCTGCAAAGCAGCTCAGCCACGG - Intergenic
1179281961 21:39941377-39941399 CCTGGGAAGCAGCTATCCCAAGG - Intergenic
1181776699 22:25165315-25165337 ACAGAGAAGTAGCTCGTCCAAGG + Intronic
1182797543 22:33001919-33001941 CCTGACAAACAGCTGAGCCAGGG + Intronic
1183716365 22:39535656-39535678 GCAGTGAAGCCGCTCATCCAGGG - Intergenic
1184273603 22:43398341-43398363 GAGGGGAAGCAGCTCATCCAAGG - Intergenic
1185007287 22:48288491-48288513 ACTCAGAAGCAGCTCATTTATGG - Intergenic
950682044 3:14592267-14592289 CCTGAGAGGCTGATGATCCATGG + Intergenic
952230593 3:31425500-31425522 CATATGAAGCAGCTCATCCCAGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG + Intronic
953348827 3:42198992-42199014 CCTGGGAAACTGCTCAGCCAGGG + Intronic
954620514 3:51992842-51992864 CATGTGAAGCAGCTGACCCAGGG + Intergenic
954847962 3:53576383-53576405 ACTGAGAATCCTCTCATCCACGG - Intronic
955744914 3:62130840-62130862 CCTGAGAAGAAGCTCAAGCCAGG - Intronic
959028719 3:101272380-101272402 CCAGAGAAGGAGGTCTTCCATGG + Intronic
960919033 3:122727896-122727918 AATGAGAAGCAACTCTTCCATGG + Exonic
961032716 3:123620425-123620447 CCAGAGAAGCAGCTGTTCCCTGG + Intronic
961303037 3:125934341-125934363 CCTGGGAACCCACTCATCCAGGG - Intronic
961885036 3:130091444-130091466 CCTGGGAACCCACTCATCCAGGG + Intronic
963480471 3:145867346-145867368 TCTGAGAAGCAGCTCAGCAGTGG + Intergenic
963826648 3:149962535-149962557 CCTGAGAAACAGGACATCAAAGG + Intronic
966158897 3:176947654-176947676 CCTGTAAAGCAGCACTTCCATGG + Intergenic
967135591 3:186510229-186510251 CATGAGAAGAAGCACAGCCAAGG + Intergenic
969178660 4:5420593-5420615 ACTGAGATGCAGCACAGCCATGG + Intronic
969217778 4:5735838-5735860 GCTGGGAAGCAGCTCTTTCAGGG - Intronic
969819707 4:9710604-9710626 CCTGGGAAACCACTCATCCAGGG - Intergenic
970589647 4:17548071-17548093 CCTGAGATCCACCTCATCCCTGG - Intergenic
971024181 4:22571717-22571739 CCTGAGAGGGAGCTCATGCTGGG - Intergenic
971394746 4:26217567-26217589 CATGAGAAGCAGCTACCCCAGGG + Intronic
971652993 4:29303829-29303851 TCTGAGGACCAGCTAATCCAGGG - Intergenic
972880918 4:43421001-43421023 GATAAGAAGCAGTTCATCCAAGG - Intergenic
973754777 4:54064229-54064251 CTTGAGCAGCTGCTCCTCCAGGG + Exonic
974606870 4:64164169-64164191 CCTGAGATACATCTCCTCCATGG - Intergenic
974998868 4:69196046-69196068 TCTGTGAAGCAGATCATTCAGGG - Intronic
975986553 4:80206303-80206325 CCTGGGCAGTAGCTCAGCCAAGG - Intergenic
979221947 4:118237133-118237155 CCAGAGAAGCAGCTCTTTTAGGG - Exonic
979760428 4:124395988-124396010 CCTGAGAGTCTCCTCATCCAAGG + Intergenic
981153755 4:141409706-141409728 CCTGAGCAACAGCTCAACGATGG + Intergenic
981156384 4:141441783-141441805 CCTGAGAAGTATTTAATCCATGG - Intergenic
983132687 4:164042142-164042164 CCTCAGAAGCTGTTCATCCTGGG + Intronic
984079983 4:175235882-175235904 CCTGATGAACAACTCATCCAGGG + Intergenic
985751603 5:1681837-1681859 CCTGAGAGGAAGTTCATGCAGGG - Intergenic
985754664 5:1706225-1706247 CCAGAGAACCAGATCAGCCACGG + Intergenic
987306215 5:16640283-16640305 CCTGAGAACCAGGTGCTCCAAGG + Intergenic
988607263 5:32689461-32689483 CCTGAGGAGCAGAGCAGCCATGG - Intronic
988794426 5:34639411-34639433 TCTGTGAAGCTGCTCATCTAAGG - Intergenic
989162062 5:38400797-38400819 CCAGAGAAGCAGCTCATTAGTGG - Intronic
989485589 5:41987756-41987778 CCTGATAATAAGCTCATCAAAGG + Intergenic
989678682 5:44004574-44004596 TTTGAGAAACAGCTCCTCCAGGG + Intergenic
992009433 5:72512058-72512080 GGTGAGGAGCAGCTCATGCAAGG + Intergenic
992273250 5:75087824-75087846 CCATAGAAACAGCTCTTCCAAGG - Intronic
992457169 5:76926497-76926519 CCTGAGGAGCAGCCAGTCCAGGG - Intergenic
993620288 5:90160460-90160482 CCTGAGAAGCATCTTATATATGG - Intergenic
998173602 5:139886659-139886681 CCAGAGAAGCCGCTAGTCCAAGG - Intronic
998179396 5:139925894-139925916 TCTCCCAAGCAGCTCATCCATGG + Intronic
998989751 5:147802637-147802659 CATAAGGAGCAGTTCATCCAGGG + Intergenic
999399060 5:151250436-151250458 CAGCAGCAGCAGCTCATCCAGGG - Intronic
1000305782 5:159993381-159993403 CTTGGAAAGCAGCTCATCCTGGG + Intergenic
1001426460 5:171625792-171625814 CCTGCTATGCAGCTCATCCGTGG - Intergenic
1007407315 6:41642489-41642511 ACTGAGAAGCAGCTCCTGCTTGG - Intronic
1016431384 6:143989550-143989572 CCTGAGAAGCAGAGGAACCAGGG - Intronic
1016581188 6:145630628-145630650 CCAGAGAAGTAGCTGGTCCAGGG + Intronic
1017019423 6:150128394-150128416 CCTGGGAAACAGCTCAGCCATGG - Intergenic
1019079646 6:169421648-169421670 CCAAGGAAGCAGCTCATCCTGGG + Intergenic
1019102086 6:169639900-169639922 TCTGAGAAGAAGCGCATCCCTGG - Intronic
1019435612 7:1020780-1020802 CCAGAGGAGCAGGACATCCAAGG - Intronic
1020813259 7:12872358-12872380 CCTGAGAACCACCTCATCTCTGG + Intergenic
1021285949 7:18781058-18781080 AATGAGAAGAAGGTCATCCAAGG - Intronic
1023028171 7:36070763-36070785 CCTGAGAAGAGGCTGATCCCTGG + Intergenic
1023653888 7:42400440-42400462 CCTGAGAAGCAGATCATTCAAGG + Intergenic
1024051071 7:45623837-45623859 CCTGAAAAGCATCACATCCTGGG - Intronic
1024253657 7:47524098-47524120 TCTGAGAGGCGGCACATCCAGGG + Intronic
1024374036 7:48618044-48618066 GATGAGAAACAGCTCTTCCATGG + Intronic
1030780159 7:113591061-113591083 CATGAGAAGAAAATCATCCATGG - Intergenic
1033355950 7:140600470-140600492 CCAGAGAAGCAGGACTTCCAGGG + Intronic
1033559228 7:142515300-142515322 CCTGAAAAGCAGCAAATCCCAGG + Intergenic
1034221246 7:149447810-149447832 GCTGAGACGCAGAGCATCCAGGG - Intronic
1034873520 7:154705050-154705072 CCAGACAAGGAGCTCCTCCAGGG + Intronic
1034966508 7:155394767-155394789 CCTGAGAGGCAGCTCCTCCATGG - Intronic
1035015451 7:155762059-155762081 CCTGAGCACAAGCTCATCCCAGG - Intronic
1036154287 8:6327409-6327431 CCTGAGAACCAGGACAGCCAAGG + Intergenic
1036381913 8:8241195-8241217 CCTGGGAACCCACTCATCCAGGG - Intergenic
1036771852 8:11584248-11584270 TCTAAGAAGAAGCTCATGCAAGG + Intergenic
1038912340 8:31980077-31980099 ACTGAGAAGTAACTCAGCCAAGG + Intronic
1039405796 8:37311503-37311525 CATCAGAAACAGCTAATCCACGG + Intergenic
1047176152 8:122542377-122542399 CCTGAGAAGCAGCTAAGCAGGGG + Intergenic
1047952415 8:129945896-129945918 CCTGAGCTGCAGCTCATGGATGG - Intronic
1048236739 8:132698382-132698404 CCTGAGAAGCAGCTTTGCAAGGG - Intronic
1049525726 8:143125907-143125929 CGAGAGAAACAGCTCTTCCATGG + Intergenic
1049710751 8:144062284-144062306 CATGAGCAGCAGCCCATCCATGG - Intronic
1049757827 8:144318627-144318649 CCTGGGGAGCAGCTCCTCCCAGG + Intronic
1050339089 9:4617928-4617950 TCTGAGAAGGGGCTGATCCAAGG + Exonic
1050676611 9:8062914-8062936 CCTGAGAGGAAGCTCATGCTGGG - Intergenic
1053048576 9:34939760-34939782 ACTGAGGAGCAGCTCCTCTATGG + Intergenic
1053787986 9:41665853-41665875 ACTGTGAAGCAGTTCCTCCAAGG + Intergenic
1054157146 9:61648915-61648937 ACTGTGAAGCAGTTCCTCCAAGG - Intergenic
1054176262 9:61877195-61877217 ACTGTGAAGCAGTTCCTCCAAGG + Intergenic
1054476921 9:65579920-65579942 ACTGTGAAGCAGTTCCTCCAAGG - Intergenic
1054661277 9:67703613-67703635 ACTGTGAAGCAGTTCCTCCAAGG - Intergenic
1056601820 9:88052792-88052814 CCTGGGATGCAGCTCCACCAGGG - Intergenic
1057822314 9:98342178-98342200 GCTTAGAAGCATCTCCTCCAGGG - Intronic
1058461863 9:105190503-105190525 CCTGAGCAGCTGCTCTGCCAAGG + Intergenic
1058492176 9:105514977-105514999 CCTGAAAAGCAACTCAGCCTAGG + Intronic
1059167670 9:112094409-112094431 TCTGTGAAACAGATCATCCAGGG - Intronic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1060229128 9:121814109-121814131 CAGGAGAAGTAACTCATCCAAGG - Intergenic
1060542459 9:124440073-124440095 GAGGTGAAGCAGCTCATCCAAGG - Intergenic
1061204835 9:129156818-129156840 TCTGAGAGGCACCTCTTCCAAGG + Intergenic
1061424878 9:130492627-130492649 CCAGAGGAGCATCTCATCTAGGG + Intronic
1062313744 9:135954718-135954740 CCTGAGATGCAGCTCATCCTCGG + Intronic
1062378621 9:136276206-136276228 CCTGAAGAGCAGCCCATCCAGGG + Intergenic
1189289997 X:39878184-39878206 CCTGCTAAGCAGCCTATCCAGGG + Intergenic
1190702165 X:52997160-52997182 CCTTAGAAGAAGCTGATCAAGGG + Intergenic
1191743939 X:64465323-64465345 CCTGAGCAGCTGCTCTGCCAAGG + Intergenic
1194607997 X:96005673-96005695 CCTGAGAAGCTGCTCTGCCAAGG - Intergenic
1197706022 X:129635022-129635044 CCTGACAAGCAGCATTTCCATGG - Intergenic
1199689845 X:150300747-150300769 CCTGAGAAGAAGCACATCTGAGG + Intergenic
1200117967 X:153777405-153777427 CCTGAGAGGAGGCTCAGCCAGGG + Intronic
1201771147 Y:17618178-17618200 CCTGAGATGCAGCACAGTCAGGG - Intergenic
1201830408 Y:18287808-18287830 CCTGAGATGCAGCACAGTCAGGG + Intergenic