ID: 953132044

View in Genome Browser
Species Human (GRCh38)
Location 3:40149391-40149413
Sequence CAGGCCCACCTCTAGCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 5, 2: 26, 3: 135, 4: 627}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953132037_953132044 -7 Left 953132037 3:40149375-40149397 CCCAAACACCTTCCACCAGGCCC 0: 32
1: 408
2: 1041
3: 1765
4: 2028
Right 953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG 0: 1
1: 5
2: 26
3: 135
4: 627
953132034_953132044 20 Left 953132034 3:40149348-40149370 CCATTCATGAGGGATATGCCTTC 0: 1
1: 9
2: 117
3: 676
4: 1811
Right 953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG 0: 1
1: 5
2: 26
3: 135
4: 627
953132033_953132044 25 Left 953132033 3:40149343-40149365 CCAAGCCATTCATGAGGGATATG 0: 4
1: 232
2: 633
3: 1003
4: 1256
Right 953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG 0: 1
1: 5
2: 26
3: 135
4: 627
953132035_953132044 2 Left 953132035 3:40149366-40149388 CCTTCAAAGCCCAAACACCTTCC 0: 1
1: 0
2: 12
3: 80
4: 615
Right 953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG 0: 1
1: 5
2: 26
3: 135
4: 627
953132038_953132044 -8 Left 953132038 3:40149376-40149398 CCAAACACCTTCCACCAGGCCCA 0: 1
1: 95
2: 923
3: 2992
4: 5617
Right 953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG 0: 1
1: 5
2: 26
3: 135
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953132044 Original CRISPR CAGGCCCACCTCTAGCATTG GGG Intronic
900196111 1:1376381-1376403 CAGGCCCACCTCTACAACTGAGG + Intergenic
900300822 1:1976253-1976275 CAGGCCCACCTCCAACACTGGGG - Intronic
900465740 1:2824689-2824711 CGGCCCCACCTCCAGCACTGGGG + Intergenic
900609092 1:3536945-3536967 AAGGCCCCCCTCCAGCCTTGCGG + Intronic
901215375 1:7551990-7552012 CAGGCCCACTTCTAGGATTCTGG - Intronic
901373761 1:8822618-8822640 CAGGCCCACTTCTACCTTGGTGG - Intergenic
901683657 1:10931244-10931266 CAGCCCTACCTCCAACATTGGGG - Intergenic
902189510 1:14752207-14752229 TAGGCCCACCTCTAATATTAGGG + Intronic
902435511 1:16395957-16395979 CAACCCCACCTCTAGTATTTTGG + Exonic
902797563 1:18809271-18809293 CAGGCCCACCCCCAGCATCCAGG + Intergenic
902828600 1:18995128-18995150 CAGGCCCTCCACTAGCATTTTGG - Intergenic
902866295 1:19282194-19282216 CAGGCTCACCTCTAACATTGGGG - Intergenic
903002878 1:20278930-20278952 AAGCCCCACCTCCAACATTGGGG + Intergenic
903542474 1:24104806-24104828 CAGGCCCACCTCCAGCACTTTGG - Intronic
903563159 1:24244464-24244486 TAGTCCCAGCTCTGGCATTGTGG - Intergenic
905002134 1:34680808-34680830 AGGCCCCACCTCCAGCATTGGGG + Intergenic
905743671 1:40394390-40394412 CAGGTCCACCTCTTCCTTTGAGG - Intronic
905889855 1:41512201-41512223 CAGGCCCACCTCTAACACTGGGG - Intronic
906132433 1:43468724-43468746 CAGTCCCACCCCTAGCTTTCAGG + Intergenic
906201434 1:43962990-43963012 CTGGCCCACCTCTAGCAGGGTGG + Intronic
907253417 1:53159331-53159353 TAGGCCCACCTCTAACACTCAGG - Intergenic
908063108 1:60372795-60372817 AAGCCCCACCTCCAACATTGGGG - Intergenic
908206793 1:61858674-61858696 AGGCCCCACCTCTAGCTTTGGGG + Intronic
908520169 1:64933999-64934021 CAGGTCCACCTCTGGAATTTGGG + Intronic
909133295 1:71766730-71766752 TAGGTCCACCTCCAACATTGAGG - Intronic
909167562 1:72248125-72248147 CAGCCCCACTTCCAGCACTGAGG + Intronic
909342749 1:74550084-74550106 TGGGCCCACCGCCAGCATTGTGG + Intergenic
909419245 1:75445110-75445132 TAGGCCCACCTCTAATATTGAGG - Intronic
910271186 1:85396539-85396561 AAGCCCCACCTCCAGCATTGGGG + Intronic
910295058 1:85636256-85636278 AAGCCCCACCTCCATCATTGGGG - Intergenic
910633281 1:89379328-89379350 TAGGCCCACCTCCAACATTGGGG + Intronic
911126803 1:94348091-94348113 CGGCCCTACCTCCAGCATTGGGG - Intergenic
912085576 1:105998503-105998525 CAGGCTCACCTCCAACATTCAGG + Intergenic
912285891 1:108368833-108368855 AAGCCCCACCTCCAACATTGGGG - Intergenic
912717804 1:111994302-111994324 TAGGCCCACCTCCAACATTGGGG - Intergenic
912854653 1:113156430-113156452 AGGCCCCACCTCCAGCATTGGGG + Intergenic
912861047 1:113214217-113214239 AGGCCCTACCTCTAGCATTGGGG + Intergenic
912972974 1:114301483-114301505 TAGCCCCACCTCCAACATTGGGG - Intergenic
913118316 1:115716927-115716949 AGGCCCCACCTCCAGCATTGGGG - Intronic
913216011 1:116620985-116621007 AGGCCCCACCTCTAACATTGGGG - Intronic
913240877 1:116828209-116828231 AGGCCCCACCTCCAGCATTGGGG + Intergenic
914895522 1:151668153-151668175 AGGCCCCACCTCTAACATTGGGG + Intronic
914905227 1:151738389-151738411 CTGGCCCACCTCCAACACTGGGG - Intergenic
915694026 1:157721234-157721256 AGGTCCCACCTCCAGCATTGAGG + Intergenic
916604088 1:166324019-166324041 TAGGCCCACCTCCAACGTTGGGG - Intergenic
916834124 1:168524671-168524693 CAGGCCCACCTTTGGCATTGGGG + Intergenic
917784736 1:178442136-178442158 AGGCCCCACCTCTAGCACTGGGG + Intronic
918263753 1:182820807-182820829 CAGCCCCACCTCCAGCACTGGGG + Intronic
919233599 1:194807880-194807902 CAGGCCTACCTCTAACACTGGGG - Intergenic
919360745 1:196591078-196591100 TAGCCCCACCTCCAACATTGGGG - Intronic
919568913 1:199221732-199221754 CAGGCCCAGCTCTGGCCTTATGG + Intergenic
919652454 1:200163929-200163951 AGGCCCCACCTCCAGCATTGGGG - Intronic
919825642 1:201501219-201501241 CTGGCCCACATCTAGCAGTGTGG - Intronic
920246428 1:204590974-204590996 AGGCCCCACCTCCAGCATTGGGG + Intergenic
920457492 1:206112272-206112294 CAGGCCCACGTCCAACACTGCGG - Intronic
920777861 1:208957980-208958002 AGGCCCCACCTCCAGCATTGGGG - Intergenic
921128166 1:212196301-212196323 AGGCCCCACCTCCAGCATTGAGG - Intergenic
921413710 1:214866467-214866489 AGGCCCCACCTCCAGCATTGAGG + Intergenic
921533868 1:216320118-216320140 CAGGCTCACCTCCAACACTGGGG - Intronic
921906580 1:220501847-220501869 CCAGGCCACCTCTAACATTGGGG - Intergenic
922325789 1:224527013-224527035 CAGGCCCGCCTCCAACATTGGGG + Intronic
922740218 1:228010303-228010325 CAGGCCCACCTCTAGGGTCCTGG - Intronic
922927655 1:229363744-229363766 CAGCCCCACCTCCAACTTTGGGG - Intergenic
923204561 1:231745813-231745835 CAGGCCCATCTCCAACACTGGGG - Intronic
923559485 1:235027895-235027917 AAGCCCCACCTCTAACATTGGGG + Intergenic
924242187 1:242051701-242051723 TAAGCCCACCTCCAACATTGAGG - Intergenic
924369908 1:243336672-243336694 CAGGCCCCCCTCCAACATCGGGG + Intronic
924792269 1:247262844-247262866 AAGCCCCACCTCCAACATTGGGG - Intergenic
924856666 1:247881228-247881250 CAGGCCCACCTCCAACACTGGGG - Intergenic
1062765137 10:56711-56733 TAGGCCCACTTCCAACATTGAGG + Intergenic
1062932096 10:1360249-1360271 CAGGCCCACCTCTGGGGCTGGGG - Intronic
1062951030 10:1503645-1503667 AAGCCCCACCTCTAACACTGAGG - Intronic
1063094588 10:2898563-2898585 CAGGCCCACCTCCAACACTGAGG + Intergenic
1063217334 10:3936673-3936695 CAGGCCCACCTCCAGCATTGGGG - Intergenic
1063411848 10:5842278-5842300 ACGGCCCACCTCCAACATTGGGG + Intergenic
1063733434 10:8724795-8724817 CAGGCACCCCTCCAACATTGGGG - Intergenic
1064002601 10:11675957-11675979 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1064423026 10:15206486-15206508 CAGGCCCACCTCCAACACTGGGG - Intergenic
1064837906 10:19555264-19555286 CAGGCTCACCTTTAACATTGGGG + Intronic
1065160147 10:22911319-22911341 AAGCCCCACCTCCAGCATTGGGG + Intergenic
1066297259 10:34065770-34065792 CAGGACCCGCTGTAGCATTGTGG + Intergenic
1066338089 10:34501186-34501208 AGGCCCCACCTCCAGCATTGGGG - Intronic
1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG + Intergenic
1067179147 10:43971895-43971917 CAGGCCCACCTGCAACACTGGGG + Intergenic
1067216304 10:44307041-44307063 GAGGCCCACCTCCAACACTGGGG + Intergenic
1067383410 10:45796184-45796206 TAGGCCCACCTCCAACACTGGGG - Intergenic
1067891114 10:50136750-50136772 TAGGCCCACCTCCAACACTGGGG - Intergenic
1068008700 10:51421011-51421033 AGGCCCCACCTCCAGCATTGGGG + Intronic
1068781615 10:60924935-60924957 AAGCCCCAACTCTAACATTGGGG - Intronic
1068891571 10:62153853-62153875 CAGCCCCACCTCCATCACTGTGG - Intergenic
1068944701 10:62718091-62718113 TAGGCCCACCTCCAACTTTGGGG + Intergenic
1069117683 10:64528365-64528387 CAGGCCCCCCTCCAACACTGGGG - Intergenic
1069650497 10:70043653-70043675 AGGTCCCACCTCTAGCACTGGGG - Intergenic
1070083144 10:73208056-73208078 AGGCCCCACCTCTAGCATTGGGG - Intronic
1070984163 10:80673768-80673790 CAGGCCCACCCCCAACATTGGGG - Intergenic
1071053981 10:81487331-81487353 AAGCCCCACCTCCAGCACTGGGG + Intergenic
1071104270 10:82076520-82076542 TAGGCCCACCTCCAACATTGGGG - Intronic
1071702563 10:87955715-87955737 AGGCCCCACCTCTAGCACTGGGG + Intronic
1072200979 10:93158612-93158634 AGGCCCCACCTCTAACATTGGGG - Intergenic
1072263639 10:93706298-93706320 AGGCCCCACCTCTAACATTGGGG - Intergenic
1072276916 10:93832848-93832870 AGGCCCCACCTCTAACATTGGGG + Intergenic
1072439606 10:95442392-95442414 CACGCCCACCTCCAACATCGGGG - Intronic
1072494301 10:95940283-95940305 AAGCCCCACCTCCAACATTGGGG + Intergenic
1074266240 10:111906382-111906404 CAGGACCCCCTCCAACATTGAGG - Intergenic
1075043708 10:119128921-119128943 CGGCCCCACCTCCAACATTGAGG + Intronic
1075312982 10:121430267-121430289 AAGCCCCACCTCCAACATTGGGG + Intergenic
1075586764 10:123664327-123664349 AGGGCCCACCTCCAACATTGGGG - Intergenic
1075720519 10:124583772-124583794 ATGCCCCACCTCTAGCATGGAGG + Intronic
1077038309 11:506252-506274 CAGGCCCCCTTCTAGGATGGTGG - Intronic
1077204054 11:1333075-1333097 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1077402296 11:2365177-2365199 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1077654526 11:4006072-4006094 CAGCCCCACCTCCAGCACTGGGG - Intronic
1078651625 11:13200206-13200228 CAAGCCCACCTCCAACATTGAGG - Intergenic
1078651650 11:13200352-13200374 CAAGCCCACCTCCAACACTGAGG + Intergenic
1078753503 11:14187269-14187291 CAGACCCAACTCCAACATTGAGG + Intronic
1079882336 11:25943869-25943891 CAGGCCCACCCCCAGCCTTCAGG + Intergenic
1080182756 11:29444130-29444152 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1080362999 11:31537775-31537797 CAGGCCCACCTCCAACACCGGGG + Intronic
1080595059 11:33765656-33765678 CAGGCCCCCCTCCAATATTGGGG - Intronic
1080822142 11:35817705-35817727 AGGTCCCACCTCCAGCATTGGGG - Exonic
1080873809 11:36259254-36259276 CAGCCCCACCTCCAGCATGCAGG + Intergenic
1081424834 11:42914566-42914588 AGGCCCCACCTCTAACATTGGGG + Intergenic
1081622847 11:44629109-44629131 CAAGGCCACCTCTGTCATTGGGG - Intergenic
1081751774 11:45516412-45516434 CAGGCTCACCTCCAGCACTGGGG - Intergenic
1082074355 11:47964674-47964696 CAGGCTCACCTCCAACACTGGGG + Intergenic
1083024723 11:59540821-59540843 AGGCCCCACCTCTAGCATTGGGG - Intergenic
1083336716 11:61926452-61926474 AAGGCCCACCTCCAACATTGGGG - Intergenic
1083918467 11:65766057-65766079 AAGCCCCACCTCCAACATTGGGG - Intergenic
1083965273 11:66039942-66039964 TAGGCCCACCTCCAACATTGGGG - Intergenic
1084782226 11:71417758-71417780 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1084935905 11:72586503-72586525 CAGGCACACCTCCAGCCTTGGGG + Intronic
1084963553 11:72731288-72731310 TAGGTCCACCTCCAACATTGGGG - Intronic
1085145574 11:74192594-74192616 AGGCCCCACCTCCAGCATTGGGG - Intronic
1085195714 11:74670454-74670476 CAGGCCCAGCTCTGCCACTGTGG + Intergenic
1085600464 11:77851543-77851565 AAGCCCCACCTCCAACATTGGGG - Intronic
1085885478 11:80517181-80517203 AAGCCCCACCTTCAGCATTGAGG - Intergenic
1086774434 11:90812491-90812513 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1087403232 11:97694977-97694999 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1087427230 11:98006081-98006103 TAGCCCCACCTCCAACATTGAGG - Intergenic
1088146378 11:106685313-106685335 CAGGCCTATCACTAGTATTGAGG + Intronic
1088968076 11:114745497-114745519 CAGGCCCACCTCCAATACTGGGG + Intergenic
1089749887 11:120643485-120643507 CAGGCCCACCGCTGATATTGGGG + Intronic
1090039249 11:123275932-123275954 TAGGCCCACCCCTAACATCGTGG + Intergenic
1090539974 11:127690823-127690845 AAGCCCCACTTCTAACATTGGGG + Intergenic
1090929461 11:131282317-131282339 CAGGCCCACCTCCAACACTGGGG + Intergenic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1091981661 12:4869104-4869126 CAGGCCCAACTCCAGCATCATGG - Intergenic
1091993015 12:4972148-4972170 TAGGCCCACCTCTAACACTGGGG + Intergenic
1092395057 12:8118695-8118717 CAGGCCCACCTCCAACACTGAGG + Intergenic
1092420248 12:8325287-8325309 AGGCCCCACCTCTAGCACTGGGG - Intergenic
1092458869 12:8669354-8669376 TAGGCCTACCTCTAACATTGGGG + Intergenic
1092471510 12:8786013-8786035 AGGCCCCACCTTTAGCATTGGGG + Intergenic
1092552682 12:9521111-9521133 AAGCCCCACCTCCAGCACTGGGG + Intergenic
1092735317 12:11576952-11576974 CAGTCCCACCTCCAACATTGGGG + Intergenic
1092811636 12:12276260-12276282 CAGCCCCAACTCCAACATTGGGG + Intergenic
1093299776 12:17439679-17439701 GGGCCCCACCTCTAACATTGGGG + Intergenic
1093553042 12:20437725-20437747 CAGGCCTACCTCCAACATTGGGG + Intronic
1093783286 12:23162057-23162079 CAGGCCCATCTCCAACATTAGGG + Intergenic
1093906826 12:24703021-24703043 CAGGCCCACCTCCAACACTGGGG - Intergenic
1094815340 12:34178277-34178299 TAGGCCCACTTCCAACATTGAGG + Intergenic
1095101648 12:38191053-38191075 TAGGCCCACTTCCAACATTGAGG - Intergenic
1095728933 12:45483778-45483800 TAGGCCCACCTCCAGTACTGGGG + Intergenic
1095948089 12:47765325-47765347 CAGGCCCCCCTCAGGCCTTGCGG + Intronic
1096621627 12:52869149-52869171 CTGGCCCACCACTGGCTTTGAGG - Intergenic
1098614775 12:72508761-72508783 CAGGCCCTCCTCCAACACTGGGG - Intronic
1098677995 12:73315528-73315550 CAGGCCCACCTCCAGGAATCTGG - Intergenic
1098734511 12:74081954-74081976 AAGCCCCACCTCCAACATTGGGG - Intergenic
1099176552 12:79429116-79429138 GGGACCCACCTCCAGCATTGGGG + Intronic
1099626066 12:85075648-85075670 AGGCCCCACCTCCAGCATTGAGG + Intronic
1099689111 12:85927741-85927763 AAGCCCCACCTCCAACATTGGGG - Intergenic
1099796538 12:87408052-87408074 CAGCCCCATCTCCAACATTGGGG - Intergenic
1100488414 12:95054257-95054279 CAGTCCCACCTCTACTATTTGGG - Intronic
1100576296 12:95894444-95894466 AAGCCCCACCTCTGACATTGGGG - Intronic
1100979523 12:100153728-100153750 CAGGGCCACCCCTCGCTTTGGGG - Intergenic
1101377006 12:104179821-104179843 CAGGCCCACCTATAACATTGAGG + Intergenic
1103158809 12:118710341-118710363 AAGCCCCACCTCCAACATTGGGG + Intergenic
1103164118 12:118755566-118755588 CAGGCCAACTTCTAACATTGAGG + Intergenic
1103542819 12:121678130-121678152 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1103993496 12:124814657-124814679 CAGGCCCGCCTCTGGGACTGGGG - Intronic
1104112386 12:125716310-125716332 CAAGCCCGCCTCCAGCACTGGGG + Intergenic
1104190465 12:126477462-126477484 TAGGCCCACCTCCAACACTGGGG + Intergenic
1104331985 12:127855576-127855598 CAGGCCCACCTCCAACACTGGGG + Intergenic
1104339161 12:127931074-127931096 AGGCCCCACCTCTAGCACTGAGG - Intergenic
1105219747 13:18314464-18314486 AGGCCCCACCTCTAACATTGGGG - Intergenic
1105256559 13:18747113-18747135 CTGGCCCACCTCCAACATTAAGG + Intergenic
1105630400 13:22157790-22157812 CAGGCCCACTTCCAACAGTGGGG + Intergenic
1106338684 13:28808037-28808059 CAGCCCCACTTCCAACATTGGGG - Intergenic
1106439865 13:29756897-29756919 CAGGCCCACCTCCAACACTGGGG - Intergenic
1106733928 13:32570322-32570344 CAGGCCCCACTGCAGCATTGGGG + Intergenic
1106758252 13:32843683-32843705 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1106856983 13:33864267-33864289 TAGGCCCACCTCTAACATTGGGG + Intronic
1106899559 13:34340821-34340843 AAGCCCCACCTCCAGCACTGGGG + Intergenic
1106940971 13:34778942-34778964 CAGGCCCACCCCTGGCTGTGAGG + Intergenic
1108077052 13:46692092-46692114 AGGCCCCACCTCCAGCATTGGGG + Intronic
1108479484 13:50853979-50854001 AGGCCCCACCTCTAACATTGGGG - Intergenic
1108731044 13:53236198-53236220 TAGGCCCACCTCCAACATTGGGG - Intergenic
1109206416 13:59487684-59487706 TAGGCCCACCTCCAACATTGGGG + Intergenic
1109304105 13:60619799-60619821 TAGGCCCATCTCTAACAGTGGGG + Intergenic
1109503281 13:63266792-63266814 AAGCCCCACCTCCAACATTGGGG + Intergenic
1109737960 13:66511600-66511622 CAAGCCCACCTTTAACATTAAGG - Intronic
1109903212 13:68802121-68802143 AGGACCCACCTCCAGCATTGGGG - Intergenic
1110800772 13:79692052-79692074 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1110890048 13:80688075-80688097 CGGCCCCACCTCCAACATTGGGG + Intergenic
1110920499 13:81078079-81078101 CAGGCCCTCCTCCAACACTGGGG + Intergenic
1111351918 13:87042048-87042070 CAGCCCCACCTCTAACATTGGGG + Intergenic
1111537523 13:89623000-89623022 CAGCCCAACCTCCAGCATTGGGG + Intergenic
1111720563 13:91938445-91938467 CGGCCCCAACTCCAGCATTGGGG + Intronic
1111894717 13:94127262-94127284 AAGCCCCACCTCCAGCATTGGGG - Intronic
1112190228 13:97169848-97169870 AAGGGCCACATCAAGCATTGTGG - Intergenic
1112515435 13:100049175-100049197 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1112909348 13:104462617-104462639 AGGCCCCGCCTCTAGCATTGGGG + Intergenic
1112924663 13:104659454-104659476 CAGTCCCACCTCCAACACTGGGG - Intergenic
1112980619 13:105380452-105380474 AAGCCCCACCTCCAGCACTGAGG + Intergenic
1113045167 13:106147558-106147580 AGCCCCCACCTCTAGCATTGGGG + Intergenic
1113061154 13:106323805-106323827 AGGCCCCACCTCTAACATTGGGG - Intergenic
1113173298 13:107531202-107531224 AATCCCCACCTCCAGCATTGGGG - Intronic
1113615278 13:111676130-111676152 CAGGCCCAACTCCAACATTGAGG + Intergenic
1113620745 13:111761043-111761065 CAGGCCCAACTCCAACACTGAGG + Intergenic
1113946984 13:114049958-114049980 CATGCCCACCTCTGGGACTGGGG - Intronic
1114171309 14:20274603-20274625 AGGCCCCACCTCTATCATTGAGG + Intronic
1114383311 14:22231666-22231688 AGGCCCCACCTCTAGCACTGAGG + Intergenic
1115111476 14:29828455-29828477 TAGGCCCACCTCTAACATAGAGG + Intronic
1115146818 14:30236246-30236268 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1115318620 14:32053682-32053704 CAGCCCCACCTCCAACACTGGGG + Intergenic
1115528634 14:34305692-34305714 CAGACCCACCTCCAACACTGGGG - Intronic
1115541007 14:34421326-34421348 CAGGGTCACCTTTAGCTTTGAGG - Intronic
1115889762 14:38013172-38013194 CCAGCCCACCTTCAGCATTGTGG - Intronic
1116061117 14:39925243-39925265 AGGCCCCACCTCCAGCATTGAGG + Intergenic
1116072527 14:40066916-40066938 CAGGCCCCCCTCCAACACTGGGG + Intergenic
1116121464 14:40725787-40725809 AAGCCCCACCTCTAACACTGGGG + Intergenic
1116136164 14:40926822-40926844 AAGCCCCACCTCCAACATTGGGG + Intergenic
1116581020 14:46641738-46641760 AAGCCCCACCTCCAACATTGGGG - Intergenic
1117800105 14:59434330-59434352 CAGGCCCGCTTCCAGCATTGGGG + Intronic
1118461584 14:65992257-65992279 CAGGCCCTCCTCCAACACTGGGG + Intronic
1118491301 14:66263391-66263413 AGGGCCCACCTCCAACATTGGGG - Intergenic
1118896074 14:69946776-69946798 AGGGCCCACCTCCAACATTGGGG - Intronic
1120044525 14:79791056-79791078 CAGCCCCACCTCCAACATTAGGG + Intronic
1120407234 14:84104534-84104556 CAGGCCCACCTCCAACAGTGGGG - Intergenic
1120557636 14:85948546-85948568 AGGCCCCACCTCCAGCATTGAGG + Intergenic
1120935175 14:89888619-89888641 AGGCCCCACCTCCAGCATTGGGG + Intronic
1121207594 14:92182469-92182491 CAGGCTCACCGCTGGCACTGGGG - Intergenic
1121264420 14:92590329-92590351 AGGCCCCACCTCCAGCATTGGGG - Intronic
1121615316 14:95310084-95310106 AGGGCCCACCTCCAGCACTGCGG - Intronic
1122004292 14:98689204-98689226 GGGCCCCACCTCCAGCATTGGGG - Intergenic
1122170426 14:99869679-99869701 CAGGCCCATCTCCAACAGTGGGG - Intronic
1123087630 14:105724144-105724166 CAGGCCCACCTCCAACACTGGGG - Intergenic
1123100811 14:105798586-105798608 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1202835472 14_GL000009v2_random:74990-75012 CTGGCCCACCTCCAACATTAAGG - Intergenic
1123541365 15:21295138-21295160 CAGGACCATCTTTAGCACTGGGG - Intergenic
1124151073 15:27178808-27178830 CAGGCCCCTCTCTAGAATGGGGG + Intronic
1124403523 15:29372812-29372834 CAGACCCATATCTAGCAGTGAGG + Intronic
1124483941 15:30099966-30099988 CAGGGCCACCTCTCGCCTTGGGG + Intergenic
1124519639 15:30397258-30397280 CAGGGCCACCTCTCGCCTTGGGG - Intergenic
1124539014 15:30568963-30568985 CAGGGCCGCCTCTCGCCTTGGGG + Intergenic
1124759636 15:32438609-32438631 CAGGGCCACCTCTCGCCTTGGGG - Intergenic
1124888798 15:33712255-33712277 AGGCCCCACCTCCAGCATTGGGG + Intronic
1124974949 15:34522709-34522731 CAGGGCCACCTCTCACCTTGGGG - Intergenic
1125457287 15:39872841-39872863 AAGCCTCACCTCCAGCATTGAGG + Intronic
1126120299 15:45245687-45245709 ATGCCCCACCTCTAGCTTTGAGG + Intergenic
1127052186 15:55096029-55096051 AAGCCCCACCTCCAACATTGGGG + Intergenic
1128313857 15:66647765-66647787 CAGGCCCAATCCTAGCATGGAGG + Intronic
1128467484 15:67925040-67925062 TAGGCCCCCCTCCAACATTGGGG + Intergenic
1128708880 15:69857280-69857302 CAGGCCCATTTCTGGCATTGAGG + Intergenic
1128826240 15:70720006-70720028 CAGGCTGACCTCCAACATTGGGG - Intronic
1129403633 15:75300587-75300609 CAGGGCCACCTCTCGCCTTGGGG + Intergenic
1129473695 15:75768938-75768960 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1129741086 15:77989955-77989977 CAGGGCCAGCCCTAGCAGTGGGG - Intronic
1129762689 15:78139891-78139913 AGGCCCCACCTCTAGCATTGGGG + Intronic
1129844633 15:78762597-78762619 CAGGGCCAGCCCTAGCAGTGGGG + Intronic
1130257194 15:82331269-82331291 CAGGGCCAGCCCTAGCAGTGGGG - Intergenic
1130282711 15:82532068-82532090 CAGGGCCACCCCTCGCCTTGGGG + Intergenic
1130562717 15:84971319-84971341 CAGTCCCACCTCCAACACTGGGG - Intergenic
1130597758 15:85258721-85258743 CAGGGCCAGCCCTAGCAGTGGGG + Intergenic
1131575046 15:93580388-93580410 AGGCCCCACCTCCAGCATTGTGG + Intergenic
1131691367 15:94831291-94831313 CTGCCCCACCTTTAACATTGGGG - Intergenic
1132965191 16:2649824-2649846 AAGGCCCAACTCTAACTTTGAGG + Intergenic
1132993224 16:2808175-2808197 CAGGCCCACCTCCAACAGTGAGG + Intergenic
1133558083 16:6924510-6924532 CAGGCCCACCTCCAACATTGGGG + Intronic
1133863963 16:9624429-9624451 AGGTCCCACCTCCAGCATTGGGG - Intergenic
1134009006 16:10837385-10837407 AAGCCCCACCTCCAACATTGGGG - Intergenic
1135203807 16:20464646-20464668 AAGCCCCACCTCTGACATTGGGG + Intronic
1135215197 16:20560293-20560315 AAGCCCCACCTCTGACATTGGGG - Intronic
1135933873 16:26762482-26762504 AAGCCCCACCTCCCGCATTGGGG + Intergenic
1137016971 16:35387181-35387203 CAGGCCCACTTGTAACATTAGGG + Intergenic
1137358538 16:47791299-47791321 AAGCCCCTCCTCTAACATTGAGG + Intergenic
1137455730 16:48616413-48616435 CAGGCCCACCACATGCATTCTGG - Intronic
1137627108 16:49916178-49916200 CAGCCCCACCTCCAACACTGAGG - Intergenic
1138216357 16:55208117-55208139 CAGGCCCAGCTCTGACATTTAGG + Intergenic
1138996103 16:62454894-62454916 AAGACCCACCTCCATCATTGGGG - Intergenic
1140041880 16:71413560-71413582 CAGGCCCACCTCTGGGTTGGAGG - Intergenic
1140331477 16:74061455-74061477 CAGGCCCACCTCCAGCGTCAGGG - Intergenic
1140609544 16:76581642-76581664 AGGCCCCACCTCCAGCATTGGGG - Intronic
1140640493 16:76966597-76966619 CAGGCCCAGCTCCAACATTGGGG - Intergenic
1141043955 16:80698549-80698571 AAGCCCCACCTCTAACACTGGGG - Intronic
1141064781 16:80905257-80905279 AAGCTCCACCTCTAACATTGGGG - Intergenic
1141248409 16:82332405-82332427 CAGACCCACCTCCAACACTGGGG - Intergenic
1141448351 16:84078978-84079000 TAGGCCCACCTCCAACATGGGGG - Intronic
1141787423 16:86211126-86211148 CAGGGCCACCTCTGGCACTGAGG + Intergenic
1142439517 16:90086606-90086628 TAGGCCCACTTCCAACATTGAGG - Intronic
1142449586 16:90167183-90167205 CAGGCCCAGCTCTTGCCTCGTGG + Intergenic
1143275867 17:5710247-5710269 TAGGCCCACCTCAAACACTGGGG - Intergenic
1143346553 17:6253735-6253757 GAGACTCACCTCTAGCTTTGTGG + Intergenic
1143441133 17:6975087-6975109 TAGGCCCACCTCCAACACTGGGG - Intronic
1144442020 17:15292197-15292219 CAGGCCCACCTCCAACAATGGGG - Intergenic
1144944668 17:18963797-18963819 CAAGCCCAGCTCCATCATTGTGG + Intronic
1145025223 17:19463200-19463222 AAGCCCCACCTCCAACATTGGGG - Intergenic
1145818757 17:27814904-27814926 AGGGCCCACCTCCAACATTGGGG + Intronic
1145840509 17:27990293-27990315 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1146022747 17:29293257-29293279 CAAGCCCACCTGTGGCCTTGGGG - Intronic
1148889029 17:50794436-50794458 CAGGCCCACTCCTAACACTGGGG + Intergenic
1150499537 17:65637420-65637442 CTGGCCCACCCCCATCATTGTGG + Intronic
1150978726 17:70118736-70118758 CAGGTCCCCCTCCAGCACTGGGG + Intronic
1151270042 17:72986996-72987018 CAGGCCCTCCTCCAGCACTGGGG - Intronic
1152532486 17:80927185-80927207 CAGGCCGTCCTCTAGAACTGCGG + Intronic
1152922415 17:83072702-83072724 GAGGCACAGCTCTGGCATTGGGG + Intergenic
1152958053 18:57052-57074 TAGGCCCACTTCCAACATTGAGG + Intronic
1153160836 18:2203154-2203176 AAGCCCCACCTCCAACATTGGGG + Intergenic
1153324374 18:3803188-3803210 CTGGACCCCCCCTAGCATTGTGG + Intronic
1153777358 18:8465707-8465729 CAGGCCCACCTCCAACATTCGGG - Intergenic
1154053096 18:10982027-10982049 AGGCCCCACCTTTAGCATTGGGG + Intronic
1155798899 18:30074759-30074781 AAGCCCCACCTCCAACATTGGGG - Intergenic
1156090802 18:33466485-33466507 AAGTCCCACCTCCAACATTGGGG - Intergenic
1156270603 18:35526972-35526994 TAGGCCCACCTCCAGCATTGGGG + Intergenic
1156312215 18:35935138-35935160 TAGGCCCACCTCCAACATTGGGG + Intergenic
1156897179 18:42259078-42259100 CAGCCCCACCTCCAACATTGGGG - Intergenic
1156957658 18:42987981-42988003 TAGCCTCACCTCCAGCATTGAGG + Intronic
1157365608 18:47061502-47061524 CAGGCCCACCTCCAACACTGGGG + Intronic
1157401436 18:47391780-47391802 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1157524873 18:48373158-48373180 AGGCCCCACCTCCAGCATTGGGG - Intronic
1157656586 18:49395879-49395901 AGGCCCCACCTCTAACATTGGGG - Intronic
1157682067 18:49615083-49615105 CAGGCCCATCCCCAGCACTGGGG + Intergenic
1157999063 18:52594879-52594901 CAGGCCCACCTCCAACATTGAGG + Intronic
1158496705 18:57961590-57961612 CAGGCCCAGGTCTTGTATTGAGG - Intergenic
1159505814 18:69333880-69333902 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1159794875 18:72830083-72830105 CAGGCCCACATCTACCTATGTGG + Intronic
1160044454 18:75373637-75373659 CCTACCCACCTCCAGCATTGTGG + Intergenic
1160144632 18:76353507-76353529 TAGGCCCACCTCCAACATTGAGG - Intergenic
1160259832 18:77282250-77282272 CAGGTCCACCTCCAGCCGTGGGG - Intergenic
1161068410 19:2249128-2249150 CAGGCCCAGCTCTATCACTGGGG + Intergenic
1161345368 19:3766545-3766567 CAGGCCCTGCTCTAGGCTTGAGG + Intronic
1161605352 19:5211881-5211903 CAGGCCCGCCTCGAGCAATGGGG - Intronic
1163168205 19:15511950-15511972 CAGGGCCACCTCTACCAAGGCGG + Intronic
1164618057 19:29678376-29678398 CAGGCCCACATCTTCCATTTTGG - Intergenic
1164801594 19:31081231-31081253 AAGCCCCACCTCCAGCATTGGGG + Intergenic
1164850816 19:31482720-31482742 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1165174691 19:33919631-33919653 AGGCCCCACCTCTAACATTGAGG - Intergenic
1165178263 19:33946033-33946055 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1165336742 19:35175864-35175886 CAGGCCCCCCTCCATCATCGGGG - Intergenic
1165527495 19:36368548-36368570 CAGGTCGCCCTCTAGCAATGTGG + Intronic
1165721658 19:38083184-38083206 CAGGCCCTGCTCTGGCACTGAGG + Intronic
1165828451 19:38718870-38718892 CAGGCCCTCCTCTAGCCTGAGGG - Intronic
1165987319 19:39781474-39781496 CAGGCCCACCTCCAACACTGGGG - Intronic
1166239090 19:41477560-41477582 CAGGACCACCTCCACCATTGGGG - Intergenic
1166241373 19:41496765-41496787 CAGCCCCACCTCCAACAGTGGGG - Intergenic
1166651543 19:44578980-44579002 TAGGCCCACATCCATCATTGGGG - Intergenic
1202637158 1_KI270706v1_random:52359-52381 CTGGCCCACCTCCAACATTAAGG + Intergenic
925553701 2:5105123-5105145 CAAACCCACCTCAAGCAATGGGG + Intergenic
926058104 2:9788212-9788234 CAGGCCCACCTTTAACACAGGGG - Intergenic
926235984 2:11044355-11044377 CAGGCCCACCTCAGACACTGGGG - Intergenic
927343530 2:22010000-22010022 AGGCCCCACCTCCAGCATTGGGG - Intergenic
927480811 2:23452426-23452448 AAGCCCCACCTCCAACATTGGGG + Intronic
927954911 2:27201369-27201391 CAGGCCCACCACAATCACTGTGG + Exonic
931700889 2:64908122-64908144 AGGCCCCACCTCCAGCATTGGGG - Intergenic
932659469 2:73639902-73639924 ATGCCCCACCTCTAACATTGGGG - Intergenic
933521682 2:83381837-83381859 CAGGCCCTCCTCTGATATTGAGG - Intergenic
933985663 2:87590193-87590215 AGGCCCCACCTCCAGCATTGGGG - Intergenic
934294586 2:91732193-91732215 AGGCCCCACCTCTAACATTGAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934918019 2:98316673-98316695 CAGGCCCTCCTCAAACATTGGGG - Intergenic
935416128 2:102821301-102821323 AAGCCCCACCTCCAACATTGGGG - Intronic
936094205 2:109519337-109519359 AGGCCCCACCTCCAGCATTGGGG + Intergenic
936308179 2:111360611-111360633 AGGCCCCACCTCCAGCATTGGGG + Intergenic
936703734 2:115044600-115044622 GTGCCCCACCTCCAGCATTGGGG + Intronic
936905837 2:117534737-117534759 AGGTCCCACCTCCAGCATTGAGG - Intergenic
937748796 2:125448285-125448307 AGGCCCCACCTCCAGCATTGGGG + Intergenic
937791765 2:125969566-125969588 CAGGCCCACCTCCAACATTGAGG - Intergenic
938123639 2:128654402-128654424 AAAACCCACCTCCAGCATTGGGG - Intergenic
939091179 2:137781599-137781621 AGGCCCCACCTCCAGCATTGGGG + Intergenic
941359117 2:164530385-164530407 TAGGCCCACCTCCAACACTGGGG + Intronic
942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG + Intronic
942549073 2:177095555-177095577 AGGGCCCACCTCCAACATTGGGG + Intergenic
943945983 2:194064926-194064948 CAGGCCCACCTCCAACACTGGGG + Intergenic
944043713 2:195384547-195384569 AGGCCCCACCTCTAACATTGGGG + Intergenic
944187709 2:196967848-196967870 CCACCCCACCTCCAGCATTGGGG - Intronic
944188671 2:196978115-196978137 CAGGCCCCCCTCTAACATTGGGG - Intronic
945013229 2:205486781-205486803 AGGCCCCACCTCCAGCATTGGGG + Intronic
945561913 2:211350053-211350075 AGGCCCCACCTCTAACATTGGGG - Intergenic
945676962 2:212866698-212866720 AGGACCCACCTCCAGCATTGGGG + Intergenic
947041977 2:225932786-225932808 CAGGGCAAACTCAAGCATTGGGG - Intergenic
947208658 2:227685492-227685514 CGGCCCCACCTCTAACATTGGGG + Intronic
947575517 2:231270531-231270553 CAGTCCCACTTCCAGAATTGTGG + Intronic
948144796 2:235700281-235700303 GAGGCCCACCTACAGCCTTGAGG - Intronic
948176281 2:235946004-235946026 AAGCCCCACCGCCAGCATTGGGG + Intronic
948585196 2:239014956-239014978 CAGGGCCACCTGTGGCAGTGTGG + Intergenic
949018707 2:241728353-241728375 CAGACCCATCTCTTGGATTGAGG + Exonic
1169414520 20:5404683-5404705 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1169830056 20:9815198-9815220 CAGGCCCACCTCCAACACTGAGG + Intronic
1171309128 20:24132046-24132068 AGGCCCCACCTCCAGCATTGAGG + Intergenic
1171396443 20:24836952-24836974 CAGGCCCACTTCCAACACTGGGG + Intergenic
1171431241 20:25084323-25084345 CAGGCCCCTCCCTGGCATTGGGG - Intergenic
1171515201 20:25726061-25726083 AGGCCCCACCTCTAACATTGGGG - Intergenic
1171777198 20:29380250-29380272 TAGGCCCACTTCCAACATTGAGG + Intergenic
1171818617 20:29812033-29812055 TAGGCCCACATCCAACATTGAGG + Intergenic
1171883315 20:30633382-30633404 CTGGCCCACCTCCAACATTAAGG + Intergenic
1171899183 20:30840981-30841003 TAGGCCCACTTCCAACATTGAGG - Intergenic
1173314814 20:41933457-41933479 TAGGCCCACCTCCAACATTGGGG - Intergenic
1173773015 20:45680214-45680236 CAGGTCCACCGCCAACATTGGGG - Intergenic
1174073905 20:47918594-47918616 AGGCCCCACCTCCAGCATTGAGG - Intergenic
1175168122 20:57060835-57060857 CAGGCCCACCCCTGGAAATGTGG - Intergenic
1175174164 20:57100579-57100601 CAGACCCACCTCCAACACTGGGG + Intergenic
1175522822 20:59613072-59613094 CAGCCCCACCTCCAACATTAGGG + Intronic
1176934706 21:14853219-14853241 TAGGCCCACCTCCAACACTGGGG - Intergenic
1176958404 21:15132257-15132279 AGGCCCCACCTCTAACATTGGGG - Intergenic
1177179942 21:17734255-17734277 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1177206704 21:18018355-18018377 AGGCCCCACCTCCAGCATTGGGG - Intronic
1177406212 21:20672141-20672163 CAGGTCCACCTCTAGCACTGGGG - Intergenic
1177735311 21:25081795-25081817 CAGCCCCACGTCCAGCACTGGGG + Intergenic
1177843248 21:26258233-26258255 CAGGCCCACCTCCAGCACTGGGG - Intergenic
1178320958 21:31605361-31605383 CAGGCCCACCTTCAACACTGGGG - Intergenic
1178324420 21:31632280-31632302 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1178415339 21:32400396-32400418 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1178729372 21:35085571-35085593 AGCCCCCACCTCTAGCATTGGGG - Intronic
1179402866 21:41100294-41100316 AGGTCCCACCTCCAGCATTGGGG - Intergenic
1179945660 21:44672723-44672745 CAGCCCCTTCTCCAGCATTGAGG - Intronic
1180332850 22:11548285-11548307 TAGGCCCACTTCCAACATTGAGG - Intergenic
1180760405 22:18198113-18198135 CAGGCACAGCTCCAGCACTGAGG + Intergenic
1180775264 22:18426583-18426605 CAGGCACAGCTCCAGCACTGAGG - Intergenic
1180808338 22:18737638-18737660 CAGGCACAGCTCCAGCACTGAGG - Intergenic
1180817352 22:18799353-18799375 AGGCCCCACCTCTAACATTGGGG - Intergenic
1180828662 22:18885369-18885391 CAGGCACAGCTCCAGCACTGAGG + Intergenic
1181071260 22:20342603-20342625 CAGGCACAGCTCCAGCACTGAGG - Intergenic
1181194335 22:21171552-21171574 CAGGCACAGCTCCAGCACTGAGG - Intergenic
1181203542 22:21233674-21233696 AGGCCCCACCTCTAACATTGGGG - Intergenic
1181215108 22:21321226-21321248 CAGGCACAGCTCCAGCACTGAGG + Intergenic
1181661586 22:24354187-24354209 CAGGCCCACCTCCAACACTGGGG + Intronic
1181995445 22:26877257-26877279 ATGGCCCACCTCAAGCATTCAGG - Intergenic
1183361630 22:37386058-37386080 CAGGCCCACCTGTCACCTTGTGG + Intronic
1183728635 22:39604542-39604564 CAGGACCACCTACATCATTGTGG - Intronic
1184132047 22:42522657-42522679 AGGCCCCACCTCTAGCACTGGGG - Intergenic
1184899580 22:47436598-47436620 CAGGCCCACCTCCAACAATGGGG - Intergenic
1185252937 22:49814979-49815001 CATTCCCACCCCTAGCTTTGTGG - Intronic
1185266167 22:49905420-49905442 AGGCCCCACCTCCAGCATTGGGG - Intronic
1203223380 22_KI270731v1_random:61740-61762 AGGCCCCACCTCTAACATTGGGG + Intergenic
1203267450 22_KI270734v1_random:25080-25102 AGGCCCCACCTCTAACATTGGGG - Intergenic
1203278753 22_KI270734v1_random:111357-111379 CAGGCACAGCTCCAGCACTGAGG + Intergenic
949707684 3:6837783-6837805 AAGTCCCACCTCCAACATTGTGG + Intronic
950201055 3:11044352-11044374 TAGGCCCACCTCCAACATTTGGG - Intergenic
950458923 3:13109516-13109538 AGGCCCCACCTCCAGCATTGGGG - Intergenic
950955912 3:17053423-17053445 AGGCCCCACCTCTAGCACTGGGG + Intronic
952030251 3:29132950-29132972 CAGGCCCATCTCCAACATCGGGG - Intergenic
952637752 3:35552368-35552390 AGGTCCCACCTCCAGCATTGGGG + Intergenic
953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG + Intronic
953237394 3:41118696-41118718 TAGCCCCACCTCCAGCACTGGGG + Intergenic
953328027 3:42029187-42029209 AGGCCCCACCTCCAGCATTGGGG + Intronic
953959865 3:47258524-47258546 AGGCCCCACCTCCAGCATTGGGG - Intronic
954032738 3:47831390-47831412 CAGGCCCACCTTTGTCATTGGGG + Intronic
954368563 3:50158545-50158567 CAGGCCCATCTCTAGGATGCTGG - Intronic
955008638 3:54993104-54993126 CGGCCCCACCTCCAGCATTGGGG + Intronic
956052031 3:65258104-65258126 AGGCCCCACCTCCAGCATTGGGG + Intergenic
956683747 3:71805211-71805233 AAGTCCCACCTCCAGCATTGGGG - Intergenic
957087879 3:75699404-75699426 TAGGCCCACTTCCAACATTGAGG - Intergenic
957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG + Intergenic
957764029 3:84598230-84598252 CAGGCCCATCTCCAGCACTGGGG - Intergenic
958659663 3:97049895-97049917 TAGGCCCACCACCAGCATTGGGG + Intronic
959051266 3:101527022-101527044 AGGTCCCACCTCCAGCATTGGGG - Intergenic
960114185 3:113877056-113877078 CAGGCCAGCCTCGAGCATTTGGG + Intronic
961438200 3:126933698-126933720 CAGACCCACCTCCAACACTGGGG + Intronic
961644740 3:128386892-128386914 GAGGCCCACCTCCAACACTGGGG + Intronic
963334860 3:143963148-143963170 CAGGCTCACCTCCAGCACTGAGG + Intergenic
963500429 3:146119056-146119078 CAACCCCACCTCCAGCACTGAGG - Intronic
963553892 3:146760936-146760958 TAGGCCCACCTCCAACATTGGGG + Intergenic
965653214 3:170955270-170955292 CAGGCTCACCTCCAACATTCAGG - Intergenic
965673845 3:171174228-171174250 CAGGCTCACCTCTACCATACAGG - Intronic
965781850 3:172294549-172294571 CAGGCCCTCCTCCAAGATTGGGG + Intronic
965836820 3:172862224-172862246 AAGCCCCACCTCTAACATTAGGG - Intergenic
966096445 3:176210009-176210031 AGGTCCCACCTCCAGCATTGAGG - Intergenic
966294212 3:178400120-178400142 TAGCCCCACCTCTTACATTGGGG - Intergenic
966302549 3:178495571-178495593 AAGCCCCTCCTCTAACATTGAGG - Intronic
966934611 3:184697773-184697795 CTGGCCCTCCTCTACCTTTGTGG + Intergenic
967206751 3:187130373-187130395 AGGCCCCACCTCCAGCATTGGGG - Intronic
967730619 3:192903686-192903708 CAGGCCCGCCTCTAACTCTGGGG - Intronic
968022519 3:195405997-195406019 CAGGCTTACCTCCAGCAATGGGG + Intronic
968148969 3:196322094-196322116 AGGCCCCACCTCTAGCACTGGGG + Intronic
968378440 4:65598-65620 CAGGCCCACCTCCAACACTAGGG - Intronic
968385867 4:136933-136955 CAGGCCCACCTCCAACACTAGGG - Intronic
968760626 4:2441431-2441453 CAGGGCCACCTCCACCACTGTGG - Intronic
969913576 4:10467195-10467217 AGGCCCCACCTCCAGCATTGGGG + Intergenic
969997184 4:11324898-11324920 ATGCCCCACCTCTAGTATTGGGG - Intergenic
970237874 4:13976833-13976855 AGGCCCCACCTCCAGCATTGGGG + Intergenic
970749620 4:19342052-19342074 AAGCCCCACCTCCAACATTGGGG - Intergenic
971229464 4:24788915-24788937 CAGACCCACCTCCAACACTGGGG + Intergenic
971338512 4:25746056-25746078 AAGGCCCACCTCCAACATGGGGG - Intergenic
972341706 4:38157644-38157666 TTGGCCCACCTCCAACATTGGGG + Intergenic
972976482 4:44642601-44642623 AGGCCCCACCTCCAGCATTGGGG - Intronic
973091094 4:46137435-46137457 AGGCCCCACCTCTAGCATTGGGG - Intergenic
973614371 4:52663975-52663997 AGGCCCCACCTCCAGCATTGGGG - Intergenic
974078666 4:57191163-57191185 CAGGTCCACCTGCTGCATTGAGG + Intergenic
974107007 4:57481114-57481136 CAGGCCCACCTCCAACACTGGGG + Intergenic
975229202 4:71910918-71910940 CAGGCCCACCTCCAACACTGGGG + Intergenic
975255295 4:72227914-72227936 CAGGCACTACTCTTGCATTGGGG - Intergenic
975516957 4:75258320-75258342 AGGCCCCACCTCTAACATTGGGG + Intergenic
975859732 4:78663923-78663945 AAGCCCCACCTCTAGCACTGGGG - Intergenic
975948322 4:79736577-79736599 CAGGCCCCTCTCTAACACTGTGG - Intergenic
976493459 4:85698822-85698844 CAGCCCCACCTCCAGCATTGGGG - Intronic
976571430 4:86616493-86616515 AGGCCCCACCTCTAACATTGGGG - Intronic
976946884 4:90781160-90781182 AAGCCCCACCTCCAGCACTGGGG + Intronic
977449533 4:97177043-97177065 AAGTCCCACCTCCAACATTGGGG + Intergenic
978056343 4:104272662-104272684 AAGCCCCACCTCCAGCATTGGGG + Intergenic
978141069 4:105318042-105318064 CAGGCCCACCTCCAATACTGGGG - Intergenic
978926065 4:114246224-114246246 AGGCTCCACCTCTAGCATTGGGG + Intergenic
979403722 4:120283073-120283095 CATGCCCACCTCTAGGCCTGGGG + Intergenic
979428184 4:120593848-120593870 CAGCCCCTCCTCCAACATTGGGG + Intergenic
979446843 4:120823824-120823846 AGGCCCCACCTCTAACATTGGGG - Intronic
979560141 4:122092588-122092610 CAGGGAAACCTCTAGCAATGTGG + Intergenic
980953395 4:139404094-139404116 AGGCCCCACCTCCAGCATTGGGG + Intronic
981041578 4:140227813-140227835 CAGGCCCACCTCCAACACTGAGG - Intergenic
981460904 4:145012862-145012884 CAGGCCCCCCTCCATCATTGGGG - Intronic
981592914 4:146384744-146384766 TAGGCCCACCTCCAACATTGGGG - Intronic
981778796 4:148401374-148401396 TATGACCACCTCTAGCACTGAGG - Intronic
982162708 4:152586168-152586190 TAGGCCCACCTTCAGCACTGGGG - Intergenic
982319686 4:154065037-154065059 CAAGCCCACCTCCAACACTGGGG - Intergenic
982621385 4:157710305-157710327 CAGCCCCACCTCCAGCATTGAGG + Intergenic
983449199 4:167889747-167889769 GAGTCCCACCTCCAACATTGAGG - Intergenic
984115912 4:175681552-175681574 GGGCCCCACCTCCAGCATTGGGG - Intronic
984188987 4:176582247-176582269 AGGCCCCACCTCCAGCATTGGGG - Intergenic
985035420 4:185834938-185834960 CAGTCCCACCTCTAACACGGGGG - Intronic
985202062 4:187494203-187494225 CAGGCCTACCTCCAACACTGGGG - Intergenic
985357078 4:189132895-189132917 CAGCCCCACCTCTAACATTGGGG - Intergenic
985362717 4:189192681-189192703 AGGCCCCACCTCCAGCATTGAGG + Intergenic
985443106 4:189999415-189999437 TAGGCCCACTTCCAACATTGAGG + Intergenic
1202764475 4_GL000008v2_random:138216-138238 CTGGCCCACCTCCAACATTAAGG + Intergenic
985906123 5:2838499-2838521 TAGGCCCACCTCCAACATTGCGG + Intergenic
985985960 5:3516504-3516526 AGGCCCCACCTCTAGCATTGGGG + Intergenic
986214139 5:5702307-5702329 CAGTCCCACCTCCAGCACTGGGG + Intergenic
986258368 5:6121071-6121093 CAGGCTTACCTCTAGAATTCTGG + Intergenic
986837241 5:11652116-11652138 AAGACCCACCTCCAACATTGGGG - Intronic
986926933 5:12766249-12766271 AAGCCCCACCTCCAGCATTAAGG - Intergenic
987065034 5:14281462-14281484 CAGGCCTACCTCCAACATTGGGG + Intronic
987337493 5:16909739-16909761 CAGGCCCGCCTCCATCACTGGGG - Intronic
987367566 5:17162709-17162731 CAGGCCCACCTCTAACACTGGGG + Intronic
987800627 5:22692026-22692048 AAGTACCACCTCTAACATTGGGG - Intronic
988366628 5:30309225-30309247 CAGCCCCACCTCCAACATTAGGG - Intergenic
988425478 5:31058624-31058646 AGGCCCCACCTCTAGAATTGGGG - Intergenic
989150965 5:38299469-38299491 AGGGCCCACCTCTGACATTGGGG - Intronic
989193206 5:38691115-38691137 CAGGCCCTCTTCCAACATTGAGG + Intergenic
989229237 5:39067404-39067426 AAGCCCCACCTCCAGCATTGGGG + Intronic
989575665 5:42985900-42985922 AAGTCCCACCTTTAACATTGGGG - Intergenic
990520491 5:56574523-56574545 AGGCCCCACCTCTAGCATTGGGG + Intronic
990597348 5:57324822-57324844 CAGGCCCACCTCCTGCTTTCTGG - Intergenic
991401419 5:66255771-66255793 CAGGCCCACCTGCAACACTGAGG - Intergenic
991772568 5:70053418-70053440 CATGCCCACCTCCAACACTGGGG + Intronic
991851861 5:70928842-70928864 CATGCCCACCTCCAACACTGGGG + Intronic
993107191 5:83612582-83612604 CAGGGCCACCTAGAGCCTTGAGG + Intergenic
993125676 5:83833162-83833184 AGGCCCCACCTCTAGCATTGAGG - Intergenic
993254047 5:85564930-85564952 CAGGCCCACCTCCAACATTAGGG - Intergenic
993305946 5:86275599-86275621 AAGCCCCACCTCCAACATTGGGG - Intergenic
993340782 5:86722766-86722788 CAGCCCCACCTCCAACATTGGGG + Intergenic
993956096 5:94234799-94234821 CAGCCTCACCTCCAACATTGGGG + Intronic
994077299 5:95667785-95667807 CAGACCCACCTCCAGTATTTGGG - Intronic
994854442 5:105099022-105099044 CAGGCCCACTTCCAGCACTGGGG - Intergenic
995060229 5:107805514-107805536 TAGGCCCACCTCCAACATTGGGG + Intergenic
995181585 5:109235218-109235240 AGGCCCCACCTCCAGCATTGAGG - Intergenic
995254014 5:110025312-110025334 AGGCCCCACCTCCAGCATTGGGG - Intergenic
995467880 5:112469521-112469543 AAGCCCCACCTCCAGCACTGGGG + Intergenic
995605579 5:113851067-113851089 CAGTCCCACCTCCAACATTTGGG + Intergenic
995932106 5:117458349-117458371 CATGCCAATCTCTAGCAGTGAGG - Intergenic
996876924 5:128250501-128250523 AGGCCCCACCTCCAGCATTGGGG - Intergenic
997182793 5:131849128-131849150 AGGGCCCACCTCCAACATTGGGG - Intronic
997515530 5:134486594-134486616 TAGGCCCACCTCCAGCATTGTGG - Intergenic
997825576 5:137104122-137104144 CAGCCCCACCTCCAACACTGGGG - Intronic
997981279 5:138468905-138468927 CATGCTCACCTCTAGCCTTAAGG + Exonic
998018425 5:138751275-138751297 CAGCCCCACCTCCAACACTGGGG + Intronic
998941573 5:147288761-147288783 AGGCCCCACCTCCAGCATTGGGG + Intronic
999319126 5:150602314-150602336 CTGGCCCAACTCTGCCATTGTGG - Intronic
999571411 5:152924181-152924203 AGGCCCCACCTCCAGCATTGAGG - Intergenic
999659332 5:153842585-153842607 CGGCCCCACCTCCAACATTGGGG - Intergenic
999700943 5:154227895-154227917 AAGCCCCACCTCCAGCACTGGGG - Intronic
1000361205 5:160449209-160449231 CAGCCCCACCTCCAGCATTTAGG - Intergenic
1000408170 5:160910866-160910888 AGGCCCCACCTCTAACATTGAGG - Intergenic
1000418146 5:161005751-161005773 CAGGCCCAGTTTCAGCATTGAGG - Intergenic
1001845543 5:174917964-174917986 CAGGGCCACCTCTCACCTTGGGG - Intergenic
1002461309 5:179375311-179375333 AGGTCCCACCTCCAGCATTGAGG + Intergenic
1003389137 6:5698433-5698455 AGGCCCCACCTCCAGCATTGGGG + Intronic
1007212050 6:40201299-40201321 AGGGCCCACCTCCAACATTGAGG - Intergenic
1007642775 6:43355973-43355995 CAGGGCAACCTCTACCAATGGGG - Exonic
1008277858 6:49561990-49562012 AAGCCCCACCTCTAACATTGGGG - Intergenic
1008518770 6:52343500-52343522 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1008750977 6:54733483-54733505 CAGGCCCCTCTCCAACATTGGGG + Intergenic
1009055323 6:58328045-58328067 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1009235837 6:61122533-61122555 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1009460941 6:63912630-63912652 CAGGCCCCCCTCCAACATTGGGG - Intronic
1009642723 6:66359051-66359073 CAGGTCCTCCTCTCACATTGAGG + Intergenic
1010426616 6:75734891-75734913 AGGCCCCACCTATAGCATTGGGG + Intergenic
1010466944 6:76178813-76178835 AGGTCCCACCTCCAGCATTGGGG + Intergenic
1011115774 6:83889975-83889997 AGGCCCCACCTCCAGCATTGAGG + Intronic
1011414256 6:87101186-87101208 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1011540651 6:88424433-88424455 CAAGCTCACCTCTAACACTGGGG - Intergenic
1011645651 6:89455530-89455552 CAGCCCCACCTCCAACATTGGGG - Intronic
1011810699 6:91128947-91128969 AAGCCCCACCTCCAGCGTTGGGG - Intergenic
1011829861 6:91358432-91358454 AAGCTCCACCTCCAGCATTGAGG + Intergenic
1012187071 6:96232032-96232054 AGGCCCCACCTCTAGCACTGGGG + Intergenic
1012497662 6:99852475-99852497 AAGCCCCACCTCCAACATTGGGG - Intergenic
1012677841 6:102139070-102139092 CAGGCCCACTCCCAGCATTAGGG + Intergenic
1012701841 6:102467575-102467597 CATGCTCTCCTCTAGCAGTGAGG - Intergenic
1012747698 6:103115684-103115706 CAGGCCCATCTCTAATTTTGGGG - Intergenic
1013133873 6:107261249-107261271 CAGCCCCACCTCCTGCATTGGGG - Intronic
1013201893 6:107906032-107906054 AGGCCCCACCTCCAGCATTGGGG - Intronic
1013400578 6:109791999-109792021 AAGGACCAACTCTAGCTTTGGGG + Intronic
1013798443 6:113911448-113911470 CAGACCCACCTCTAACACTGGGG - Intergenic
1014099041 6:117489374-117489396 AGGCCCCACCTCCAGCATTGGGG + Intronic
1014415382 6:121177175-121177197 AAGCCCCACCTCCAACATTGTGG - Intronic
1014435415 6:121415621-121415643 AGGCCCCACCTCTAGCACTGGGG - Intergenic
1014771300 6:125460151-125460173 AGGGCCCACCTCCAGCATTGGGG + Intergenic
1014987423 6:128029069-128029091 AAGTCCCATCTCCAGCATTGGGG - Intronic
1015207782 6:130660104-130660126 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1015336157 6:132041379-132041401 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1015585570 6:134772691-134772713 CAGGACCACCTCCAACACTGGGG - Intergenic
1015684575 6:135845514-135845536 AGGCCCCACCTCTAACATTGGGG - Intergenic
1016180350 6:141139056-141139078 AAGCCCCACCTCCAACATTGAGG - Intergenic
1016414665 6:143820143-143820165 CAGCCCCACCTCCAGCATTGGGG + Intronic
1016525050 6:144992031-144992053 AGGTCCCACCTCCAGCATTGGGG + Intergenic
1016911624 6:149204853-149204875 AGGCCCCACCTCTAACATTGGGG + Intergenic
1017028108 6:150198297-150198319 CAGGCCCTCCTCCACCATGGCGG - Intronic
1017047101 6:150356965-150356987 AAGCCCCACCTCTAACACTGGGG - Intergenic
1017058996 6:150463401-150463423 TGGCCCCACCTCCAGCATTGAGG + Intergenic
1017949729 6:159126640-159126662 CAGACCCATCTCTTGAATTGAGG - Intergenic
1018006123 6:159623846-159623868 AGGCCCCACCTCTAACATTGGGG - Intergenic
1018608359 6:165622831-165622853 GGGCCCCACCTCCAGCATTGGGG - Intronic
1018805063 6:167252850-167252872 AGGCCCCACCTCTGGCATTGGGG - Intergenic
1018944106 6:168333780-168333802 CAGCCCCACCTCCAACACTGGGG + Intergenic
1019172835 6:170143925-170143947 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1019920935 7:4163026-4163048 CAGGCCAAGCTCTAGCCCTGGGG - Intronic
1019956706 7:4420781-4420803 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1020060659 7:5149358-5149380 CAGACCCACCTCCAACACTGGGG - Intergenic
1020629568 7:10624304-10624326 CAGGCCCACCTCTAACATTGGGG + Intergenic
1021293049 7:18869266-18869288 AAGCCCCACCTCCAGCATTAAGG - Intronic
1021659450 7:22905169-22905191 CAGGCCCACCTCCAACACTGGGG + Intergenic
1021758710 7:23882104-23882126 CAGGCCCACCTCCAACATTGGGG + Intergenic
1021841460 7:24724792-24724814 AGGGCCCACCTCTAGCACTGGGG - Intronic
1022259758 7:28692614-28692636 CAGGCCAACCTCGGGCATGGTGG + Intronic
1022525130 7:31032277-31032299 AGGCCCCACCTCTAACATTGAGG - Intergenic
1023391175 7:39713248-39713270 AGGGCCCACCTCCAGCATTGGGG - Intergenic
1023714872 7:43033686-43033708 AGGCCCCACCTCTAACATTGAGG + Intergenic
1023781826 7:43663010-43663032 AAGCCCCACCTCCAACATTGGGG - Intronic
1023985923 7:45095930-45095952 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1024459778 7:49648206-49648228 CAGGCCCTCCTCCAACACTGAGG + Intergenic
1024687177 7:51758647-51758669 CAGCCCCACCTCCAGCATTGGGG + Intergenic
1024708189 7:51984768-51984790 CAGGCCCAGCTCCAGTAATGGGG + Intergenic
1024869993 7:53953968-53953990 CAGCCCCATCTCCAGCATTGGGG + Intergenic
1024896010 7:54263112-54263134 CAGGCCCACTTCCAACACTGAGG + Intergenic
1025810959 7:64875211-64875233 CATGCCCACATCTAGGATCGCGG - Intronic
1026138049 7:67680637-67680659 CAGGCCCACCTCCAACATTGGGG + Intergenic
1026512092 7:71035877-71035899 CCTTCCCACCTCTAGCAGTGTGG + Intergenic
1026560321 7:71443387-71443409 CAGGCCCACCTCCAACACTGCGG - Intronic
1026651827 7:72222551-72222573 CAGGCCCCCCTCCAACACTGGGG + Intronic
1026679177 7:72452326-72452348 AGGCCCCACCTCTAACATTGGGG - Intergenic
1027202980 7:76074444-76074466 CAGGCCCAGCTCTCGCCTCGCGG - Intergenic
1027528363 7:79299751-79299773 AGGCCCCTCCTCTAGCATTGGGG - Intronic
1027948074 7:84776920-84776942 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1028516019 7:91679100-91679122 AAGCCCCACCTCCAACATTGGGG - Intergenic
1028831050 7:95326991-95327013 CTGTCCCACCTCCACCATTGGGG - Intergenic
1028862533 7:95669632-95669654 CATGCTCACCTCTAGCAGTGTGG + Intergenic
1029195048 7:98799510-98799532 AGGTCCCACCTCCAGCATTGGGG - Intergenic
1030721600 7:112877679-112877701 AGGCCCCACCTCCAGCATTGGGG - Intronic
1031078195 7:117232800-117232822 CAGGCTCACCTCCAGCATTTGGG + Intergenic
1031855936 7:126922699-126922721 AGGCCCCACCTCCAGCATTGGGG - Intronic
1033104836 7:138511691-138511713 AGGTCCCACCTCCAGCATTGGGG + Intronic
1034411877 7:150946274-150946296 AAGGCCCATCTCTAGCAGAGGGG + Intronic
1034699530 7:153084105-153084127 CAGCCCCATCTCCAGCATGGGGG + Intergenic
1035014985 7:155758015-155758037 AAGCCCCACCTCCAGCACTGGGG + Intronic
1035235740 7:157496782-157496804 CCGGCCCACCCCAAGCATCGCGG - Intergenic
1036731051 8:11265164-11265186 CAGCCCCACCTCCAGCACTGGGG - Intergenic
1036913690 8:12784287-12784309 CAGGCCTACCTCTAGCATGGGGG - Intergenic
1036914564 8:12792903-12792925 CAGGCCCAACTCCAACATTGGGG + Intergenic
1037016686 8:13916228-13916250 CTGTCTCACCTCTAACATTGGGG - Intergenic
1037109870 8:15153520-15153542 CGGCCCCACCTCCATCATTGGGG - Intronic
1037172183 8:15906070-15906092 CAGGCCCACCCCCAGCACTGGGG + Intergenic
1037392854 8:18412905-18412927 CAGTCCCACCTCCAACATTAAGG - Intergenic
1038224541 8:25643696-25643718 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1038534020 8:28340908-28340930 TAGGCCCACCTCCAACATTAGGG + Intronic
1038693793 8:29786992-29787014 AAGCCCCACCTCCAGCACTGGGG - Intergenic
1039108707 8:34018662-34018684 TAGGCCCACCTCCAACATTGGGG + Intergenic
1039128456 8:34231590-34231612 CATGCCCACCTTTAGCATGACGG + Intergenic
1039226139 8:35390258-35390280 AGGCCCCACCTCCAGCATTGGGG + Intronic
1039287832 8:36061865-36061887 AGGCCCCTCCTCTAGCATTGGGG - Intergenic
1039859045 8:41440599-41440621 TAGGCCCACCTCCAACATCGGGG + Intergenic
1040529852 8:48257781-48257803 TAGGCCCACCTCCAATATTGGGG + Intergenic
1041027758 8:53704158-53704180 CGGGCCCACCTCTAACACTGGGG - Intergenic
1042030608 8:64471792-64471814 CAGGCCCACCTCCTACATGGGGG + Intergenic
1043102358 8:76061498-76061520 CAGGTCCACCTCCAAAATTGGGG - Intergenic
1043274195 8:78372833-78372855 AGGCCACACCTCTAGCATTGGGG + Intergenic
1043480238 8:80645482-80645504 AGGCCCCACCTCCAGCATTGGGG - Intronic
1044140439 8:88644678-88644700 AAGCCCCACCTCCAGCACTGGGG + Intergenic
1044412909 8:91903858-91903880 CAGGCCCTCCTCCAACAGTGAGG + Intergenic
1044930394 8:97246642-97246664 AGCCCCCACCTCTAGCATTGTGG - Intergenic
1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG + Intronic
1045996153 8:108364564-108364586 TAGGCCCACCTCCAGCACTGGGG + Intronic
1046134028 8:110003679-110003701 AGGGCCCACCTCCAACATTGAGG + Intergenic
1047442755 8:124893136-124893158 AGACCCCACCTCTAGCATTGTGG + Intergenic
1048500564 8:134971011-134971033 AGGCCCCACCTCTAGCATTGGGG - Intergenic
1048523890 8:135183439-135183461 CAGGCCCACCTCCAACATGAGGG - Intergenic
1048608918 8:136000814-136000836 CATGCCCCCCTCCAGCAATGGGG - Intergenic
1049009909 8:139880369-139880391 CAGATCCAGCTGTAGCATTGGGG + Intronic
1049148081 8:141016795-141016817 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1049517241 8:143066977-143066999 CAGGCCCACCTCCACCACTGGGG - Intergenic
1049839411 8:144761504-144761526 CAGGCCCACCGCCAGCATTGGGG - Intergenic
1051040864 9:12809193-12809215 AGGCCCCACCTCTAGCATTGGGG + Intronic
1051922472 9:22284050-22284072 CGGCCCCACCTCCAGCACTGGGG + Intergenic
1052268303 9:26599977-26599999 CAGGCCCATCTCTTCCTTTGCGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053513184 9:38706914-38706936 CATGCCCTCCTCTAGCAATTAGG + Intergenic
1053616020 9:39766694-39766716 CAAGCCCTCCTCTAGCCCTGAGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053874193 9:42526004-42526026 CAAGCCCTCCTCTAGCCCTGAGG + Intergenic
1053898427 9:42768581-42768603 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054237497 9:62575696-62575718 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054268140 9:62940750-62940772 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054551633 9:66610207-66610229 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054936987 9:70698657-70698679 CAGGCCCACCTCCAACACCGGGG - Intronic
1054949562 9:70834932-70834954 AAGCCTCACCTCTAACATTGGGG - Intronic
1055089455 9:72347945-72347967 CAGGCCCACCTCTAGCACTGGGG - Intergenic
1055139490 9:72859732-72859754 CAGACCCACCTCCAACATTGGGG + Intergenic
1055191486 9:73530079-73530101 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1055307324 9:74943188-74943210 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1055813564 9:80179285-80179307 AAGCCCCACCTCTAATATTGGGG + Intergenic
1055856024 9:80689962-80689984 AAGCCCCACCTCTAACATTGGGG - Intergenic
1055904336 9:81275354-81275376 CAGGCTCCCCTCCAACATTGGGG + Intergenic
1055924063 9:81491965-81491987 AGGCCCCACCTCTAACATTGGGG - Intergenic
1056367745 9:85922703-85922725 AGGCCCCACCTCTAACATTGGGG + Intergenic
1056496647 9:87161859-87161881 CAGCCCCTCCTCCAACATTGGGG + Intergenic
1056525789 9:87441811-87441833 AAGGCCCAATTCCAGCATTGGGG + Intergenic
1056623142 9:88232030-88232052 TAGACCCACCTCCAACATTGGGG - Intergenic
1056670596 9:88624662-88624684 CAGGTCCACCTCCAACATCGGGG + Intergenic
1056903787 9:90626959-90626981 GGGCCCCACCTCCAGCATTGGGG - Intronic
1057976863 9:99614378-99614400 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1058045746 9:100354811-100354833 AGGCCCCACCTCCAGCATTGAGG + Intergenic
1058636340 9:107042076-107042098 CAGTCCCACCTCCAACACTGAGG - Intergenic
1059464592 9:114459908-114459930 CAGCCCCACCTCCAACACTGGGG - Intronic
1059472287 9:114514779-114514801 AGGCCCCACCTCTAACATTGGGG + Intergenic
1060502441 9:124171116-124171138 CAGGCCCACCTCCAACACTGAGG + Intergenic
1062740113 9:138167549-138167571 TAGGCCCACTTCCAACATTGAGG - Intergenic
1203545223 Un_KI270743v1:123103-123125 CTGGCCCACCTCCAACATTAAGG + Intergenic
1203570798 Un_KI270744v1:128652-128674 CAGGCCCACCTCCAACACTAGGG + Intergenic
1185672548 X:1824407-1824429 CAGACCCACCTCCAACAATGGGG + Intergenic
1185672586 X:1824581-1824603 CAGCCCCACCCCTAACACTGGGG + Intergenic
1185672628 X:1824812-1824834 CAGCCCCACCTCCAACATTGGGG + Intergenic
1185672661 X:1824986-1825008 CAGCCCCACCTCCAACAATGGGG + Intergenic
1185672675 X:1825044-1825066 CAGACCCACCTCCAACACTGGGG + Intergenic
1185672711 X:1825218-1825240 CAGCCCCACCTCCAACAATGGGG + Intergenic
1185672769 X:1825508-1825530 CAGCCCCACCTCCAACACTGCGG + Intergenic
1185672838 X:1825798-1825820 CAGACCCACCTCCAACACTGGGG + Intergenic
1185672958 X:1826378-1826400 CAGCCCCACCTCCAACACTGGGG + Intergenic
1185673011 X:1826607-1826629 CAGACCCACCTCCAACACTGGGG + Intergenic
1185673066 X:1826839-1826861 CAGCCCCACCCCTAACACTGGGG + Intergenic
1185817694 X:3171545-3171567 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1186388387 X:9133151-9133173 CTCCACCACCTCTAGCATTGGGG + Intronic
1186413204 X:9361623-9361645 AGGACCCACCTCCAGCATTGGGG - Intergenic
1186529684 X:10282552-10282574 AGGCCCCACCTCTAACATTGAGG + Intergenic
1186552464 X:10521252-10521274 AAGCCCCACCTCCAGCATTGGGG + Intronic
1187050570 X:15691709-15691731 AAGCCCCACCTCCAACATTGGGG + Intronic
1187081884 X:15998684-15998706 CAGGCCCACCTCCAACATTGGGG + Intergenic
1187209026 X:17210593-17210615 AGGCCCCACCTCCAGCATTGAGG + Intergenic
1187757038 X:22539444-22539466 ACAGCCCACCTCTAACATTGGGG - Intergenic
1188146166 X:26616533-26616555 AAGCCCCACCTCCAACATTGGGG + Intergenic
1188166374 X:26869712-26869734 CCGGCCCCACTCCAGCATTGGGG + Intergenic
1189374447 X:40455731-40455753 CAGGCCAACCTCCAGCTCTGGGG + Intergenic
1189467890 X:41291407-41291429 CAGGCCCCCCTCTCACATTCTGG + Intergenic
1189776035 X:44470765-44470787 CGGCCCCACCTCCAACATTGGGG + Intergenic
1191877577 X:65811839-65811861 AGGCCCCACCTCCAGCATTGAGG - Intergenic
1192404782 X:70873935-70873957 CAGCCCCACATCCAACATTGGGG - Intronic
1192757399 X:74060821-74060843 AAGCCTCACCTCTAACATTGAGG + Intergenic
1194895124 X:99431333-99431355 AAGCCCCACCTCCAGCATTGTGG - Intergenic
1195035277 X:100966323-100966345 CAGGCCCACTTCCAACATTAGGG - Intergenic
1195512405 X:105732311-105732333 CAGCCCCACCTCCAACAATGGGG - Intronic
1197019057 X:121664279-121664301 CAGGCCCTTTTCTAGCATTGAGG + Intergenic
1197524870 X:127548432-127548454 CAGGCCCAACTCCAACACTGGGG - Intergenic
1197667379 X:129238412-129238434 AGGCCCCACCTCCAGCATTGGGG + Intergenic
1197915584 X:131530815-131530837 AAGGCCCTCCTCCAACATTGGGG - Intergenic
1198066886 X:133107007-133107029 AGGTCCCACCTCTAACATTGTGG + Intergenic
1198153418 X:133933560-133933582 AGGCCCCACCTCCAGCATTGGGG - Intronic
1198261026 X:134965025-134965047 CCAGCCCACCTCCAACATTGGGG + Intergenic
1198305345 X:135376799-135376821 AGGTCCCACCTCCAGCATTGGGG - Intergenic
1198793962 X:140376109-140376131 CAGGCCCACCTCCAACAGTTGGG + Intergenic
1198977900 X:142357939-142357961 AGGCCCCACCTCCAGCATTGGGG - Intergenic
1199134612 X:144235380-144235402 AGGCCCCTCCTCTAGCATTGAGG - Intergenic
1199360362 X:146910562-146910584 CGGCCCCACTTCCAGCATTGAGG + Intergenic
1199635780 X:149810328-149810350 CAGGCCCACCCCTAACCTTACGG + Intergenic
1201068021 Y:10117766-10117788 TAGGCCCACTTCCAACATTGAGG - Intergenic