ID: 953135585

View in Genome Browser
Species Human (GRCh38)
Location 3:40178978-40179000
Sequence TAGGGTACACAGAAGACGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953135585_953135589 10 Left 953135585 3:40178978-40179000 CCCTGCGTCTTCTGTGTACCCTA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 953135589 3:40179011-40179033 GACAAGCAGAGTCTGTGCGTAGG 0: 1
1: 0
2: 0
3: 10
4: 98
953135585_953135591 23 Left 953135585 3:40178978-40179000 CCCTGCGTCTTCTGTGTACCCTA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 953135591 3:40179024-40179046 TGTGCGTAGGAAAGAAAAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 216
953135585_953135590 22 Left 953135585 3:40178978-40179000 CCCTGCGTCTTCTGTGTACCCTA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 953135590 3:40179023-40179045 CTGTGCGTAGGAAAGAAAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953135585 Original CRISPR TAGGGTACACAGAAGACGCA GGG (reversed) Intronic
903949066 1:26983745-26983767 TAGGGTACAGAGAAGATTCAAGG + Intergenic
904963987 1:34357486-34357508 TAGTGTACACAGAAATCGCCTGG + Intergenic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
917496044 1:175540971-175540993 TAGAGTACAGAGAGGAGGCAGGG - Intronic
918217727 1:182407590-182407612 TAGGGTAGCCAGAAGATGAATGG - Intergenic
921137410 1:212273906-212273928 TATGGGACACAGAAGAGGAAAGG - Intergenic
922358985 1:224803747-224803769 TACTGTACACAGAGGACACAGGG + Intergenic
1063991962 10:11576266-11576288 GAGTGTACCCAGAAGAGGCATGG + Intronic
1068882809 10:62067878-62067900 CAGTGTACACAGGAGACACAAGG + Intronic
1072792984 10:98332229-98332251 GAGGGTACACACAAGATGCAGGG - Intergenic
1072925008 10:99609450-99609472 TAGGATACTCAGAAGACAGAAGG - Intergenic
1077471908 11:2767720-2767742 CAGAGTACTCAGTAGACGCATGG - Intronic
1080414657 11:32058063-32058085 TAAGGGACACAGCAGACTCATGG - Intronic
1081867963 11:46369961-46369983 CTGGGTACACAGACGACGCCAGG + Exonic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1091394044 12:142805-142827 TAGGGGACACAGAAAAGGAAGGG - Intronic
1095837382 12:46653595-46653617 TAGGATGGACAGAAGACACATGG + Intergenic
1098995682 12:77116914-77116936 TAGGGTTCACAGAACACTGAAGG - Intergenic
1099114465 12:78607479-78607501 TAAGGTTCACAAAAGAGGCAGGG + Intergenic
1102095208 12:110234206-110234228 TAGGGTATACTGGAGACGCTGGG - Intergenic
1107787174 13:43968945-43968967 CTGGGTACACAGACGACGCCAGG + Intergenic
1118054887 14:62069563-62069585 TAGGCCACACAGGAGACTCATGG + Intronic
1118256735 14:64211852-64211874 AAGGGTACCCAGAATACTCAGGG - Intronic
1121200762 14:92115562-92115584 TAGGATACACACAGGAAGCAAGG - Intergenic
1127723853 15:61728437-61728459 TAGGGTACACAGAGGACACCCGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1138371815 16:56533077-56533099 CAGGGGACACAGAAGACTAAAGG + Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1140205778 16:72932105-72932127 TAGAGTACACAGGACACTCAGGG - Intronic
1143779829 17:9223617-9223639 CAGGGGACACTGAAGACCCAGGG - Intronic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1150007208 17:61477183-61477205 AAGGGTTAACAGAAGCCGCAGGG + Intronic
1156075399 18:33271334-33271356 TACGGTTCACAAAAGACACATGG + Intronic
1156541196 18:37912696-37912718 TTGTGTGCACAGAAGACACATGG - Intergenic
1157001991 18:43537919-43537941 AAGGGTCCACAAAAGAGGCAGGG + Intergenic
1157865515 18:51180326-51180348 TTGGGTACAGAGAAGACAAATGG + Intronic
1161053640 19:2179018-2179040 TAGGGGAGACAGGAGACACAAGG - Intronic
926002216 2:9342848-9342870 GATAGTACACAGAAGACACAGGG - Intronic
926175055 2:10583493-10583515 AATGTGACACAGAAGACGCATGG + Intronic
926760625 2:16275740-16275762 TAGGGTGGACAGAAGCCACATGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930543251 2:52734377-52734399 TAGAGTACACAGAAAACTTAAGG - Intergenic
931835628 2:66095925-66095947 AAGGGTGCACAGCAGACGAAAGG - Intergenic
935070918 2:99692685-99692707 TAGGGTTCAGAGAAGAGGGAAGG - Intronic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
1169399831 20:5270433-5270455 ATGGGTACACAGAGGACACATGG - Intergenic
1171172647 20:23029165-23029187 TAGGGTACACTGAAAAAGCATGG + Intergenic
1175476474 20:59278510-59278532 TAGGGCACACAGCAAACCCATGG + Intergenic
1182509737 22:30810362-30810384 AAGTGTACACAGAAGACACAAGG - Intronic
1183218380 22:36496019-36496041 TGGGGCACACAGAAGATGCCTGG - Exonic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
953351012 3:42216145-42216167 AAGGGGACACAGAAGAGGCTGGG - Intronic
953930418 3:47003139-47003161 AAGGGTACTCAGCAGAAGCAAGG - Intronic
964694008 3:159486693-159486715 TATGTCACACAGAAGATGCAGGG + Intronic
964770932 3:160224460-160224482 TAGGGCACACAGCACACGTAAGG - Intergenic
967022686 3:185536300-185536322 TAAGATACTCAGAAGAGGCAAGG + Intronic
967915429 3:194574784-194574806 TAGGGTTCTCAGAAAACTCAGGG + Intergenic
970551674 4:17188001-17188023 TAGGGTACAAAGATGAGGTAAGG - Intergenic
976962079 4:90989976-90989998 TAGGGTACCCAGAAGATGTCTGG + Intronic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
979338414 4:119490572-119490594 TAGGGTACACTAAATAGGCATGG - Intergenic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
984127925 4:175835169-175835191 TAGGGTCCAAAGGAGAAGCACGG - Intronic
987447113 5:18033730-18033752 TAGGGTAGACAGGAGATCCATGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
991179704 5:63735655-63735677 TAAGGTAAATAGAAGATGCATGG - Intergenic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
1006388601 6:33746084-33746106 TAGGGTACCTAGAAGAGTCATGG + Intronic
1006435568 6:34024301-34024323 AAGGGAAAAGAGAAGACGCATGG - Intronic
1007530289 6:42536053-42536075 CAGTGGACACAGAAGACCCATGG - Intergenic
1009852833 6:69219239-69219261 TAGGATACACAGAAAACCCTAGG - Intronic
1009876343 6:69510369-69510391 TAGGATGCACAGAAAACTCAAGG - Intergenic
1011892642 6:92185973-92185995 GAGAGTACACAGAAGATGCTTGG + Intergenic
1018068279 6:160139069-160139091 CAGGGCACTCAGAAGACTCAGGG - Intronic
1027536625 7:79411267-79411289 TAGGGTACAAAGAAGAATTAAGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1034588508 7:152118096-152118118 TAGGGTAGAGAGAAGAGGAAGGG - Intronic
1036705470 8:11043080-11043102 CAGAGTACTCAGAACACGCAGGG + Intronic
1041006183 8:53498848-53498870 TAGCCTAAACAGGAGACGCATGG + Intergenic
1041362157 8:57065811-57065833 TGGGGTACACAAAAGAAGGAGGG - Intergenic
1047231627 8:123002536-123002558 TGGGGGACACAGAATACGCAAGG - Intergenic
1050462134 9:5886020-5886042 AAGGGAACACAGTGGACGCATGG + Intronic
1057140984 9:92726687-92726709 TGGGGGACACAGCAGACCCAGGG + Intronic
1186637096 X:11418201-11418223 GTGGGTGCACAGAAGACTCAAGG + Intronic
1186695369 X:12025130-12025152 TAGGTTACACAGAAGAAAGAAGG - Intergenic
1188906369 X:35796976-35796998 TAGAGTACACAGAAATCGGAGGG + Intergenic
1189977025 X:46472038-46472060 TAGGGTACACAGAATTTCCATGG - Intronic
1190747414 X:53332691-53332713 GAGGGAGGACAGAAGACGCAGGG - Intergenic
1199395995 X:147338858-147338880 TGGGGTACAGAGAATAAGCATGG - Intergenic