ID: 953135691

View in Genome Browser
Species Human (GRCh38)
Location 3:40179868-40179890
Sequence GTGTCCCTCTTGATACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953135683_953135691 7 Left 953135683 3:40179838-40179860 CCAATCCCAAGGTACACCAGGGC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
953135680_953135691 12 Left 953135680 3:40179833-40179855 CCTAGCCAATCCCAAGGTACACC 0: 1
1: 0
2: 2
3: 6
4: 90
Right 953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
953135688_953135691 -9 Left 953135688 3:40179854-40179876 CCAGGGCCAAGGGCGTGTCCCTC 0: 1
1: 0
2: 1
3: 17
4: 168
Right 953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
953135686_953135691 1 Left 953135686 3:40179844-40179866 CCAAGGTACACCAGGGCCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
953135684_953135691 2 Left 953135684 3:40179843-40179865 CCCAAGGTACACCAGGGCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953135691 Original CRISPR GTGTCCCTCTTGATACATGG AGG Intronic
905941886 1:41869892-41869914 GTGTTCCTCTTGAAACATATTGG + Intronic
906654980 1:47541585-47541607 GGGTCCCTCCTGAAACATGAGGG - Intergenic
908441237 1:64156805-64156827 GGGTTCCTCTTGTTTCATGGAGG - Intronic
911537404 1:99116840-99116862 GTGTCCCTCCCAAAACATGGGGG + Intergenic
912662915 1:111549769-111549791 CTGTAGCTCTAGATACATGGGGG - Intronic
914410310 1:147421096-147421118 GTCTGCCTCATGATGCATGGAGG - Intergenic
915637675 1:157197871-157197893 GTGTGCCTCCTGCTACCTGGTGG - Intergenic
917960496 1:180140593-180140615 TTGTCCCTCTCTATCCATGGGGG + Intergenic
918064651 1:181090979-181091001 GTGTCTCTCTTGATACTTAGTGG - Intergenic
920933818 1:210412676-210412698 GGGTGCCTCTGGACACATGGTGG + Intronic
921054076 1:211531012-211531034 GTTTCCCTGCTGATAAATGGGGG + Intergenic
921115330 1:212084851-212084873 TTGTCCCTCAGGATCCATGGGGG + Intronic
924550336 1:245070174-245070196 GTGTCCCTCTGTATCCATGGTGG - Intronic
1064342251 10:14497955-14497977 GTTTCCCTGTAGATAAATGGGGG + Intergenic
1069243728 10:66174753-66174775 TTGTCCCTCAGTATACATGGGGG - Intronic
1074609727 10:115010011-115010033 TTGTCCCTCTGTATCCATGGGGG - Intergenic
1075653276 10:124144060-124144082 GTGTCCTTCTTCATATGTGGTGG + Intergenic
1086235323 11:84623264-84623286 GTTTCCCTCTTGAAAAAAGGTGG - Intronic
1086965830 11:93027198-93027220 TTGTCCATGTTGATACATGTAGG - Intergenic
1090298845 11:125616130-125616152 TTGTCCCTCTGTATCCATGGAGG + Intronic
1094282727 12:28757931-28757953 GTCCCTCTCTTGACACATGGGGG - Intergenic
1096503785 12:52080750-52080772 GCCTCCCTCTTGAGACAGGGAGG + Intergenic
1098219479 12:68253357-68253379 TTGGCCCTCTTGGTACAGGGAGG - Exonic
1099904586 12:88757140-88757162 GTGATCCTTTTGTTACATGGAGG - Intergenic
1100109975 12:91228932-91228954 GTGACCCTCTTTATTTATGGAGG - Intergenic
1102015474 12:109645266-109645288 CTGCCCCTCTTCCTACATGGGGG + Intergenic
1105704251 13:22959868-22959890 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1105715748 13:23062555-23062577 GTGCCGTTCTTGATACATGTTGG - Intergenic
1105857202 13:24384920-24384942 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1108607022 13:52049870-52049892 TTGTACCTCCTGATACCTGGTGG - Intronic
1109198908 13:59409548-59409570 GTGTCCCCCTTGAGAGGTGGTGG - Intergenic
1111857394 13:93655371-93655393 ATGTCCCTCTTGAAACAGAGTGG + Intronic
1112942919 13:104888350-104888372 GTTTCTCCCTTGACACATGGGGG - Intergenic
1113055495 13:106262597-106262619 GTGTTGTTCTTTATACATGGAGG + Intergenic
1113534375 13:111052641-111052663 GTGTCCCTCCAGATACAGGGAGG - Intergenic
1117255696 14:53975270-53975292 GTGGCCCCCTTGAGACCTGGTGG + Intergenic
1118833304 14:69455753-69455775 GTTTCCTTCTTGATGCATGCTGG + Exonic
1118904981 14:70017321-70017343 TTGTCCCTCTTGTTTGATGGAGG + Intronic
1202894201 14_KI270722v1_random:188576-188598 GAGTCCCCCTTTATCCATGGGGG - Intergenic
1128723907 15:69973822-69973844 GTGTCCCCCTGAACACATGGAGG - Intergenic
1138136358 16:54526573-54526595 GTGTCCCTTTTGATCCAAGCAGG + Intergenic
1140828434 16:78728852-78728874 GTTTCCTCCTTGTTACATGGAGG + Intronic
1142682692 17:1559709-1559731 GTGTCCTTCTTGCTTCCTGGGGG - Intronic
1148134434 17:45283225-45283247 CTGTCCCTCTTGAGAGGTGGTGG - Intronic
1150792983 17:68214339-68214361 GTGTCCTGCTTGAAGCATGGAGG + Intergenic
1152172509 17:78762003-78762025 GTGTCCATCATGTGACATGGGGG + Intronic
1153240263 18:3025081-3025103 GTGGCCCTCTGGATAAGTGGTGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
926643755 2:15265993-15266015 GTCCCGCTCTTGACACATGGGGG - Intronic
928800149 2:35079381-35079403 GTCTCTCCCTTGACACATGGGGG + Intergenic
932811338 2:74828846-74828868 GTATCTGTCTTTATACATGGTGG - Intergenic
933051051 2:77602914-77602936 GTGTCCCTTTGTATGCATGGGGG + Intergenic
938905978 2:135836599-135836621 GTGACGCTCTTGATTCCTGGTGG + Exonic
940479881 2:154214670-154214692 ATGTCCTTCTTCACACATGGCGG - Intronic
940735433 2:157446057-157446079 GTGTCCCTTGTGATAAAGGGTGG + Intronic
943771972 2:191727726-191727748 GTGTCCTTCTGTATACGTGGAGG + Intergenic
943897354 2:193382316-193382338 GGGACCTTCTTGTTACATGGGGG - Intergenic
948733414 2:239981668-239981690 TTGTCCTTGTTGATACCTGGAGG - Intronic
1169779935 20:9298110-9298132 GTGTCCCACTTTATGCCTGGAGG + Intronic
1179521112 21:41945619-41945641 GTCCCTCTCTTGACACATGGTGG - Intronic
1185333652 22:50262218-50262240 GTATCCCTCTTTCTACACGGAGG + Intergenic
950921694 3:16701234-16701256 GTGTCCCTGTTGAATCGTGGTGG - Intergenic
952541404 3:34371473-34371495 GTGTCCCTCCCGAAACATGTGGG - Intergenic
953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG + Intronic
960065437 3:113367274-113367296 GTGTCTCTCAGGCTACATGGGGG - Intronic
966745348 3:183269688-183269710 GTGTCCATCTTAATACATGTTGG - Exonic
971293762 4:25370846-25370868 TTCTCCCTTTTGTTACATGGAGG + Intergenic
972250690 4:37297131-37297153 TTGTCCCTCTGTATCCATGGGGG + Intronic
972640633 4:40921958-40921980 GTGTCCCTTTCGATCCATGATGG - Intronic
973021894 4:45213665-45213687 GTTACCCTTTTGATACATGAAGG - Intergenic
974508606 4:62808072-62808094 GTGTCCCTCTGGAGGCCTGGGGG + Intergenic
976475574 4:85478766-85478788 AAGTCCCTCTTGATTCTTGGTGG + Intronic
976600448 4:86933815-86933837 GTGTCCCTGATGAAACCTGGTGG - Intronic
977959297 4:103067461-103067483 CTGTGCTTCTTGATGCATGGAGG + Exonic
980188512 4:129493788-129493810 TTGTCCCTCTTTATCCATAGGGG - Intergenic
981014808 4:139962856-139962878 TTAACCCTCTTGTTACATGGGGG + Intronic
981542594 4:145861109-145861131 GTGCCCATCTGGATACATGCTGG - Intronic
981560253 4:146040609-146040631 GTTACTCTATTGATACATGGGGG - Intergenic
992033286 5:72745907-72745929 GTCTCTCCCTTGACACATGGGGG + Intergenic
998298104 5:140991304-140991326 TTGTCCCGCATGATACATGAAGG + Intronic
999275269 5:150325760-150325782 CCCTCCCTCTTGATGCATGGTGG + Intronic
1001249929 5:170139422-170139444 GGCTCCCTCTTGTTACATGATGG + Intergenic
1005527762 6:26667958-26667980 GGGTCCCTCCTGAGACATGTGGG + Intergenic
1005543031 6:26833720-26833742 GGGTCCCTCCTGAGACATGGGGG - Intergenic
1005559304 6:27021280-27021302 GTGTCCCACTTGGGACACGGAGG + Intergenic
1008227328 6:48936580-48936602 GTTTCCCTTTTGGTCCATGGTGG + Intergenic
1009013851 6:57875890-57875912 GGGTCCCTCCTGAGACATGTGGG - Intergenic
1009577570 6:65486548-65486570 GTGTCTTTCTTGAATCATGGAGG - Intronic
1010612002 6:77963873-77963895 GTGTCCCTCTTAAAACATGTGGG - Intergenic
1023196113 7:37641585-37641607 TGGTCCCTCCTGAAACATGGAGG + Intergenic
1030882708 7:114901101-114901123 GTTTCCCTCATGAGACTTGGGGG - Intergenic
1044871214 8:96621694-96621716 GTGTCCCTCTAGATAGAAGATGG - Intergenic
1044923521 8:97189522-97189544 GTCTCTCCCTTGACACATGGGGG + Intergenic
1048625107 8:136176771-136176793 GTCTCTCCCTTGACACATGGGGG - Intergenic
1058354790 9:104071695-104071717 TTCTCCCTGCTGATACATGGTGG - Intergenic
1060435647 9:123590483-123590505 GTTTCCTCCTTGATAAATGGGGG + Intronic
1186265933 X:7833887-7833909 GTATGACTCTTGGTACATGGTGG - Intergenic
1186838359 X:13460029-13460051 GTCTCCATGTTGAAACATGGAGG - Intergenic
1187153228 X:16700689-16700711 TTCTCCCTCATGTTACATGGGGG + Intronic
1187227085 X:17383708-17383730 GTGTCCCTCCTCTTACATTGGGG + Intronic
1200842274 Y:7794805-7794827 TTGTCCCTTTTTATACTTGGAGG - Intergenic
1202170151 Y:22034829-22034851 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202221215 Y:22551544-22551566 GAGTTCCTCTGGAAACATGGCGG - Intergenic
1202321900 Y:23644118-23644140 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202548867 Y:26025938-26025960 GAGTTCCTCTGGAAACATGGCGG - Intergenic