ID: 953136807

View in Genome Browser
Species Human (GRCh38)
Location 3:40188874-40188896
Sequence TTCCCACGTGTCTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953136807 Original CRISPR TTCCCACGTGTCTGTGGGGT GGG (reversed) Intronic
901701004 1:11044771-11044793 CTGCCACGTGTCTCTGGGGTGGG - Intronic
901822582 1:11839714-11839736 TTCCCACGTGTCACTGTTGTTGG - Intronic
907217828 1:52880913-52880935 TTCCCTGGTTTCTGTGGGGCAGG - Intronic
907909623 1:58814932-58814954 TTCCCACGACGCTTTGGGGTAGG - Intergenic
908757738 1:67484590-67484612 TTCCCAGGGCTCTGTGGGGGTGG + Intergenic
909686207 1:78352018-78352040 TTCCCAGGAGTGTGTGAGGTTGG + Intronic
911809588 1:102258368-102258390 TTTCCAGGTGTCTGAGGGGAGGG + Intergenic
912672332 1:111642289-111642311 TCCTCACATTTCTGTGGGGTGGG - Intronic
915800050 1:158781345-158781367 TTCTCACCTGTCTCTGGGGTTGG - Intergenic
916682393 1:167116392-167116414 TTGCCACCTGTCTGTGGGCTGGG + Intronic
918188251 1:182146594-182146616 TTACCAGGTGTCTGTGGGTGTGG - Intergenic
918522384 1:185429035-185429057 TTTCCAGGTGAATGTGGGGTAGG + Intergenic
919883796 1:201918168-201918190 TGTCCCAGTGTCTGTGGGGTGGG - Intronic
920180797 1:204130686-204130708 CTCCCAGCTGTCAGTGGGGTGGG - Intergenic
923221056 1:231893574-231893596 TTGCCATGTGTTTGTGGGTTGGG + Intronic
1067702833 10:48586035-48586057 TTCCCTCCTCTCTGTGGGGTTGG + Intronic
1069614089 10:69795419-69795441 TTCCCACATGACTCTGGGCTTGG + Intergenic
1071994891 10:91137715-91137737 TTCTCAGGTGTCTTTGGGCTTGG + Intergenic
1073329552 10:102661405-102661427 CTCCCAGCTGTCTTTGGGGTGGG + Intergenic
1073636211 10:105201292-105201314 TCTTCACCTGTCTGTGGGGTGGG + Intronic
1075732467 10:124644693-124644715 TTCCCACATGGCTGTGGGTAGGG + Intronic
1076498475 10:130915262-130915284 TTCCCACTGGCCTGTGGGGCAGG - Intergenic
1077388685 11:2288887-2288909 TGCACACGTGTGTGTGGTGTTGG - Intergenic
1077519874 11:3026562-3026584 TTCCCAAGAGTCTGAGGGGTGGG + Intronic
1078110428 11:8387805-8387827 TTCCCATGTGACTGAAGGGTGGG - Intergenic
1079396157 11:20065673-20065695 TGCCCACCTGTCTCTGGGGTTGG - Intronic
1083386445 11:62313772-62313794 GTCCCACGTGTGGGAGGGGTGGG - Intergenic
1083750569 11:64758587-64758609 CTACCAGGTGTGTGTGGGGTGGG - Exonic
1084323301 11:68385337-68385359 GACCCAGGTGGCTGTGGGGTGGG + Intronic
1087714067 11:101586718-101586740 TTTCCACGGACCTGTGGGGTGGG + Intronic
1090373238 11:126271375-126271397 TTCCCACATGGTTGGGGGGTTGG - Intronic
1090645187 11:128761385-128761407 TGCCCACGTGTCAGTGAGGGAGG - Intronic
1091008786 11:131979131-131979153 TTTCCACATGTCTGTGGGCAGGG + Intronic
1091154437 11:133360727-133360749 TCCCCACGTGGCCGTGGGGAAGG - Intronic
1092854394 12:12659171-12659193 TTCCCCTGTGTCTGGGAGGTAGG + Intergenic
1098612007 12:72470348-72470370 TTCCTAAGTGTCTATGTGGTGGG - Intronic
1099715384 12:86287194-86287216 TTCCCTGGTGTGTGTAGGGTGGG - Intronic
1100350518 12:93777117-93777139 TTCTCACGGGCCTGTGGGTTGGG + Intronic
1101674604 12:106906549-106906571 TTCCTGGGTGTCTGTGTGGTTGG - Intergenic
1103017940 12:117510193-117510215 TTTCCACGTATCAGTGGGCTTGG - Intronic
1108355886 13:49628446-49628468 TTCCCAGGTGGCTGGGGGGCGGG - Exonic
1109327260 13:60882903-60882925 TTCCAATGTGTCTGTCTGGTGGG - Intergenic
1110295464 13:73859196-73859218 TTCACAAAAGTCTGTGGGGTAGG + Intronic
1111691245 13:91565824-91565846 AATCCAGGTGTCTGTGGGGTTGG + Intronic
1111943055 13:94633537-94633559 TTCCCACTTTTCTATTGGGTTGG + Exonic
1112033343 13:95476297-95476319 TTCCCACGGTTCTGGAGGGTGGG + Intronic
1112453720 13:99538116-99538138 TTTCCACGTGTCAGTGGGGAGGG + Intronic
1113242159 13:108350040-108350062 GTCCCACGTGTCTGGGTGGTTGG + Intergenic
1113994346 14:16053862-16053884 CTCCCTCGTGTCTGTGGTGGTGG + Intergenic
1116606266 14:46999884-46999906 TTCACACATGTCTAAGGGGTTGG + Intronic
1116954377 14:50908945-50908967 TTGCCTCGTACCTGTGGGGTAGG + Exonic
1118025238 14:61762009-61762031 TTCCCAAGTGGGAGTGGGGTTGG + Intergenic
1118761079 14:68880433-68880455 TGCGCGCGTGGCTGTGGGGTTGG - Intronic
1119224919 14:72937723-72937745 TGGCAACGTTTCTGTGGGGTAGG + Intronic
1122117388 14:99534736-99534758 GTCTCACCTGTCTGTGGAGTGGG - Intronic
1122664340 14:103318277-103318299 TCCCCAGGTGTCGATGGGGTGGG + Intergenic
1122771846 14:104101147-104101169 TTCCCACGTGCGTGTGGGTGTGG + Intronic
1125720078 15:41841166-41841188 TGCCCAGGTCTCTGTGGGGTGGG + Intronic
1127414877 15:58748970-58748992 TTCCCACGAGTCTGCGCGGCGGG + Intronic
1131067304 15:89442575-89442597 ATCCTAAGTCTCTGTGGGGTGGG + Intergenic
1131855057 15:96584954-96584976 TTGCTAAGTATCTGTGGGGTTGG + Intergenic
1132322422 15:100935767-100935789 TTCCCAGGTTTCTGTGGGTCAGG + Intronic
1132350480 15:101136760-101136782 TTCCCACGTATTTGAGGAGTGGG + Intergenic
1132562212 16:601155-601177 CTCCCACGTGTGTGTGGAGCTGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1133748872 16:8708847-8708869 TTCTCATGAGTCTGTGGAGTAGG - Intronic
1135086783 16:19481499-19481521 TTCCCACATGACTGTGGAGCTGG + Intronic
1137496374 16:48972194-48972216 TTCCCAGGTGTCTGTAGAGATGG - Intergenic
1137719475 16:50619598-50619620 TTCCCAGGAGTCAGTGGGGTGGG + Intronic
1138320024 16:56103726-56103748 TACCCAGGTGGCTGTGAGGTTGG + Intergenic
1138759269 16:59522177-59522199 TTCCCACTTTTCTGGAGGGTAGG - Intergenic
1139179684 16:64732056-64732078 GTCCCACTTTTCTGTGGAGTGGG - Intergenic
1141393383 16:83682934-83682956 TTCCTAAGTTTCAGTGGGGTTGG - Intronic
1141536219 16:84682173-84682195 TCCCCACCTGTCTTTGAGGTGGG + Intergenic
1142005882 16:87689431-87689453 CCTCCAAGTGTCTGTGGGGTGGG + Intronic
1142197187 16:88744379-88744401 GCCCCACGTGCCTGTGGGGCAGG - Intronic
1142685418 17:1574753-1574775 GTCCGAGGTGTGTGTGGGGTCGG - Exonic
1143439427 17:6957575-6957597 TTCACCTGTGTGTGTGGGGTAGG - Intronic
1145935439 17:28712112-28712134 TTCCCAAGGGTCGGTGGGGCGGG - Intergenic
1152108462 17:78343799-78343821 TGCCCATGTGGCTGGGGGGTGGG - Intergenic
1152192605 17:78897638-78897660 GTCCCACGTGTCTGTTCGGGGGG - Intronic
1152408791 17:80111821-80111843 TCCCCACGCCTCTGTGGGGCTGG - Intergenic
1152922194 17:83071641-83071663 TGCCCACGACTCTGTGGGGTTGG + Intergenic
1154218093 18:12430084-12430106 GTCCCCCGTGTGTGTGGGTTCGG + Intronic
1156510115 18:37629175-37629197 TTTCCAAGTTTCTGTGGGTTGGG - Intergenic
1160280508 18:77485675-77485697 TTCCCACAGGTGTGTGGGGTGGG - Intergenic
1162060211 19:8090241-8090263 CTGCCGTGTGTCTGTGGGGTGGG + Exonic
1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG + Exonic
1164668811 19:30061636-30061658 CTCCCTCGTGTCTGTGGGTGTGG + Intergenic
1165264208 19:34646812-34646834 TTCTGGCGTCTCTGTGGGGTTGG + Intronic
1166725098 19:45022127-45022149 TCCCCACGAGGCTGTGGGGGTGG - Exonic
1168145667 19:54419043-54419065 TTCCTGCGTGGCTGGGGGGTCGG - Intronic
1168236862 19:55069088-55069110 TTCCCAGGTCTCTGGGGGATGGG - Intronic
926861117 2:17309847-17309869 TTCCCACCTGACGGTCGGGTTGG - Intergenic
927151924 2:20201128-20201150 GTCCAAGGTGTCTGCGGGGTAGG + Exonic
927408532 2:22799415-22799437 CTCCCATGTGTCTGTGGAGCAGG - Intergenic
928355065 2:30604953-30604975 CTCCCACCTGTGTGTGGGGGCGG - Intronic
928756052 2:34526883-34526905 TCCCCATGTGTCTCTGGGATAGG - Intergenic
928937935 2:36699966-36699988 TTGCCACAGCTCTGTGGGGTAGG - Intronic
931702250 2:64918604-64918626 TCCCCAGGTGACTGTGAGGTAGG - Intergenic
932028412 2:68158112-68158134 TTCCCACCCCTCTGTGGGGACGG + Exonic
939542847 2:143514670-143514692 TTCTCATGTGTCTGTGGTGCAGG + Intronic
940583340 2:155609899-155609921 TTCCCGGCTGTCTTTGGGGTGGG - Intergenic
941649277 2:168075976-168075998 TTCCCAAATGTCTTTGTGGTTGG + Intronic
944510165 2:200456667-200456689 CTCCCACTTGTGTGTGGGGTTGG - Intronic
948264906 2:236629079-236629101 TTCCCTCCTGTGTGTGGGGACGG + Intergenic
948917239 2:241040516-241040538 CTCACACCTGTCTCTGGGGTGGG + Intronic
948925725 2:241095774-241095796 TTGTCACGTGTCTGTGGGGAGGG - Exonic
1171866213 20:30488793-30488815 CTCCCTCGTGTCTGTGGCGGTGG - Intergenic
1174074038 20:47919472-47919494 TTCCCACATGTCTGAAGGGTTGG + Intergenic
1174729084 20:52896836-52896858 GTCCCACGTGGCTGGGGGGGGGG + Intergenic
1175382187 20:58570907-58570929 TTTCCACATCTCTGTGGGCTTGG - Intergenic
1175758617 20:61546079-61546101 TTCACACGTGTGTGTGTGGAGGG + Intronic
1175896780 20:62339964-62339986 TTACCACCTGTCTGAGGCGTTGG - Intronic
1179302870 21:40128271-40128293 TTCATTCGTGTCTGTGTGGTAGG + Intronic
1179304196 21:40140020-40140042 TGCGCACGTGTATGTGGTGTCGG + Intronic
1180312923 22:11253653-11253675 CTCCCTCGTGTCTGTGGTGGTGG - Intergenic
1180342321 22:11628704-11628726 CTCCCTCGTGTCTGTGGCGGTGG + Intergenic
1180843123 22:18968422-18968444 TCCCCACCTGTCTGTGCAGTGGG - Intergenic
1181001993 22:19992149-19992171 TTCCCAGCTGTCGGTGGGGCTGG - Intronic
1181920342 22:26315611-26315633 TTCCCATGTGACTTTGGGCTGGG + Intronic
1183453841 22:37910890-37910912 TTCCCATGTGACCATGGGGTTGG - Intronic
1183472226 22:38015821-38015843 TTCCCAAGTTTCTGTGAGATAGG + Intronic
950056058 3:10025845-10025867 TTCCCACCTGTCTATGAGGGAGG + Intergenic
951931013 3:27967235-27967257 TTCACACTTGTGTGTGGGGGTGG - Intergenic
952599053 3:35056626-35056648 TTCTCACAAGTCTGTGGGTTGGG + Intergenic
953136807 3:40188874-40188896 TTCCCACGTGTCTGTGGGGTGGG - Intronic
953699824 3:45187038-45187060 TTCCAGCGTGGCTGTGAGGTTGG + Intergenic
956681854 3:71788351-71788373 TTCTCCCGTGTGTGTGGGGGGGG - Intergenic
956867159 3:73381178-73381200 TCCCCACGTGTCTCTGGATTTGG - Intergenic
963771530 3:149391153-149391175 TCCACAGCTGTCTGTGGGGTTGG + Intergenic
965250871 3:166342574-166342596 TTCCCATGGGTCTGTGGTGATGG + Intergenic
966472622 3:180308396-180308418 TTGCCACATGTCATTGGGGTGGG + Intergenic
967113472 3:186316207-186316229 TTCCCATGAGTCTGTGGGTCAGG - Intronic
967955881 3:194876900-194876922 TTCCCACCTGGCTGGGGGCTTGG + Intergenic
968003208 3:195221789-195221811 TTTCCATTTGTCTGTGGTGTTGG - Intronic
968749955 4:2383432-2383454 GTTCCACGTGGCTGTGGGGCAGG - Intronic
969317575 4:6391218-6391240 TTCCAAGGTGTGTGTGGGGGTGG - Intronic
970539933 4:17067533-17067555 TTCCAACGTGTCTTTGGTATAGG + Intergenic
972717209 4:41658249-41658271 TTGCCACGTGTCAGTGCTGTTGG - Intronic
974858801 4:67494649-67494671 TTCCCACCTTTCTGTGATGTTGG - Intronic
976437879 4:85039785-85039807 TTCCCTAGGGTCTGTGGGCTAGG + Intergenic
979146459 4:117253254-117253276 TTCCCACTTTTCTGGAGGGTAGG + Intergenic
982377932 4:154715098-154715120 TTCCGAAGTGTCTCTGGGGAAGG + Intronic
985550636 5:531771-531793 TTCCCACCTGCCAGTGGGGGTGG + Intergenic
985775730 5:1840843-1840865 TTCCCACGTGCCTGTGTGTCCGG - Intergenic
986811853 5:11368380-11368402 TGACCACTTGGCTGTGGGGTTGG + Intronic
987506398 5:18779096-18779118 TTTCCATGTGTGTGTGGGGGTGG + Intergenic
987790213 5:22556393-22556415 TTCTCACGTTTCTGTGGAGATGG - Intronic
993509497 5:88754125-88754147 TTCCCACTGGTCAGTGGGGGAGG + Intronic
995547352 5:113246399-113246421 TTCCCCTCTTTCTGTGGGGTAGG - Intronic
998931527 5:147186801-147186823 TTCCCATGTTTCTGTTGTGTTGG - Intergenic
999301612 5:150494217-150494239 TGCACACGTGTGTGTGGTGTGGG + Intronic
1001467755 5:171983477-171983499 TTGCCACTGGTATGTGGGGTAGG + Intronic
1002684460 5:180997297-180997319 TTTCCACTTGGCTGTGGGCTGGG - Exonic
1003051732 6:2786644-2786666 TTCAGACGTGTCTGAGGGTTTGG + Intronic
1003598862 6:7500234-7500256 TTCCCATGTGTCCCTGAGGTAGG - Intergenic
1007152722 6:39710283-39710305 TACCCATGTGTCTATGGGGAAGG - Intronic
1007395348 6:41574686-41574708 TTCCCACGTCTCTCTGAGGTGGG + Intronic
1007460673 6:42016478-42016500 TTCCCAACTGTCAGTGAGGTAGG - Intronic
1013398560 6:109768778-109768800 TTCCCCCGTGTTTGTGGGCAGGG - Intronic
1017758339 6:157548861-157548883 TTACCATGTGTCTGTGTGATGGG + Intronic
1018964733 6:168475662-168475684 TTCCCACGCGTCTGTGGCCCAGG + Intronic
1019529537 7:1496495-1496517 CACCCACGTGTTTGTGGAGTGGG - Intronic
1020139365 7:5604209-5604231 TTCCCTCTTGTCTGTGTGGTTGG + Intronic
1022585338 7:31603407-31603429 TGCCAAAGTGTCTGTGGAGTGGG - Intronic
1023664966 7:42513397-42513419 TTCCCCTGTGTGTGTGGAGTGGG + Intergenic
1025562280 7:62382354-62382376 TTTCCACCTATCTGTGGTGTTGG - Intergenic
1031524391 7:122807173-122807195 TTACCAAGGGTCTGTGGGTTGGG - Intronic
1032128852 7:129212962-129212984 CTCCCAGGTGTTTGTGGGGCTGG + Exonic
1035349543 7:158236501-158236523 TGCCCTGGCGTCTGTGGGGTGGG + Intronic
1035916058 8:3624198-3624220 TTCCCATGTGTATGTTTGGTTGG - Intronic
1039566581 8:38556255-38556277 TTCACAAGTGTCAGTGGGCTGGG - Intergenic
1043402735 8:79899899-79899921 TTCCCACATTTCATTGGGGTTGG - Intergenic
1044495492 8:92875182-92875204 TGCCTATGTGTGTGTGGGGTGGG - Intergenic
1046261962 8:111780403-111780425 ATCCCAAGTGACTGTGGGATGGG - Intergenic
1046514796 8:115244561-115244583 TTCCCAGCTGTCTGTTAGGTTGG - Intergenic
1048166663 8:132067596-132067618 TTCCCACTTGGCTGTGGGAGTGG + Intronic
1048724078 8:137361673-137361695 TTCCCAGTTGTCTATTGGGTGGG - Intergenic
1049323186 8:142008211-142008233 TGCGCATGTGTCTGTGTGGTGGG - Intergenic
1055205769 9:73728578-73728600 TCCTCACGTGTATGTGGGGCAGG - Intergenic
1057824073 9:98358873-98358895 TTTCCACCCGTATGTGGGGTTGG + Intronic
1058697552 9:107572377-107572399 TTCCCAAGAGCCTGTGGAGTGGG + Intergenic
1187685813 X:21814667-21814689 ATCCCACCTGGTTGTGGGGTAGG + Intergenic
1188401682 X:29753324-29753346 TTTCCATGTCTCTGTAGGGTAGG - Intronic
1189591785 X:42520450-42520472 GTTCCACGTGTATGTGGTGTTGG - Intergenic
1190711818 X:53077087-53077109 TTCCCACCTGTCTTTGACGTGGG + Exonic
1190931225 X:54950975-54950997 TCACCACAGGTCTGTGGGGTGGG - Intronic
1191849092 X:65572405-65572427 TTCCCACCTGTCAGTGGAGAGGG + Intergenic
1193148492 X:78101864-78101886 TTCAGAACTGTCTGTGGGGTTGG - Intronic
1200107854 X:153724652-153724674 GTCCCACGTCTCTGTGGTGCGGG + Intronic
1200768358 Y:7100732-7100754 TTCACAGGTTTCTGTGGGTTTGG + Intergenic
1201077031 Y:10196414-10196436 CTCCCTCGTGTCTGTGGTGGTGG + Intergenic