ID: 953137359

View in Genome Browser
Species Human (GRCh38)
Location 3:40192882-40192904
Sequence GTTACTATGTAGAAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953137359_953137363 15 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137363 3:40192920-40192942 AGAATAAGCTCCTCCCTGGGAGG 0: 1
1: 3
2: 8
3: 24
4: 174
953137359_953137361 11 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137361 3:40192916-40192938 ATGCAGAATAAGCTCCTCCCTGG 0: 1
1: 3
2: 6
3: 22
4: 138
953137359_953137369 29 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137369 3:40192934-40192956 CCTGGGAGGGGCCTGTAGTATGG 0: 1
1: 0
2: 0
3: 16
4: 224
953137359_953137364 16 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137364 3:40192921-40192943 GAATAAGCTCCTCCCTGGGAGGG 0: 1
1: 4
2: 12
3: 28
4: 171
953137359_953137362 12 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137362 3:40192917-40192939 TGCAGAATAAGCTCCTCCCTGGG 0: 1
1: 2
2: 11
3: 43
4: 201
953137359_953137365 17 Left 953137359 3:40192882-40192904 CCATCATGCTTCTACATAGTAAC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 953137365 3:40192922-40192944 AATAAGCTCCTCCCTGGGAGGGG 0: 1
1: 2
2: 19
3: 28
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953137359 Original CRISPR GTTACTATGTAGAAGCATGA TGG (reversed) Intronic
903112675 1:21150126-21150148 GTTCCTGTGAAGAAGCAGGAGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908365090 1:63414183-63414205 GTTACTCTTTAAAAGCATTATGG + Intronic
908409175 1:63845719-63845741 GTTACTATGAAGATGCATGCAGG - Intronic
909400015 1:75217554-75217576 GTTATTGTTGAGAAGCATGATGG - Intronic
909542351 1:76804954-76804976 TTCACCATGTAGGAGCATGAAGG - Intergenic
914946773 1:152073656-152073678 ATTAGAATGTAGAAACATGAGGG + Intergenic
918969896 1:191400338-191400360 GTAAATACTTAGAAGCATGATGG - Intergenic
921571476 1:216784357-216784379 ATTACTATGGAGTAGAATGAAGG - Intronic
923476429 1:234335959-234335981 GGGACTATGTAAAAGAATGATGG + Intergenic
1066106311 10:32160430-32160452 GTTAATAGTTAGAAACATGATGG + Intergenic
1066543077 10:36470129-36470151 TTTACCATGGAGAAGAATGAGGG + Intergenic
1075128523 10:119720487-119720509 GTTTCTCTGGAGAAACATGAGGG - Intergenic
1078130265 11:8608504-8608526 GTTCCTGTTTACAAGCATGAAGG + Intergenic
1079711055 11:23682020-23682042 GCTATTATCTAGAAGCATGCTGG - Intergenic
1085679679 11:78561420-78561442 GCTCCTAAGTAGAAACATGAAGG + Intronic
1087963525 11:104382638-104382660 GTTACAGTGGAGAAGCATAAAGG + Intergenic
1092822515 12:12365736-12365758 GCTATTATGTAGAAGCATGGGGG - Intronic
1093471507 12:19506821-19506843 GTTACTATGGACAAGAATTATGG + Intronic
1093980954 12:25474988-25475010 GTTACAAGCTAGAAGCAGGAGGG + Intronic
1095437989 12:42212421-42212443 GTGATTATTTAGAAGCATGATGG - Intronic
1096303791 12:50456438-50456460 GTCACTTTTTAGAAGCAAGAAGG - Intronic
1097510601 12:60534487-60534509 TTGACTATGAAGAACCATGAAGG + Intergenic
1098174953 12:67780788-67780810 GTGACTATGTAGAGGAAAGATGG - Intergenic
1100375336 12:94010334-94010356 GTTTCTTTGTAGAAGCATGAGGG + Intergenic
1101056841 12:100926221-100926243 TTCACAATGTAGAAGCATGGTGG - Intronic
1101203154 12:102457857-102457879 GTTACTTTTTGGGAGCATGATGG + Intronic
1105466994 13:20653260-20653282 CTTTCTAAGTAGAAGCCTGATGG - Intronic
1107518215 13:41152586-41152608 GTTACTATGGAAAAGCAAGCTGG + Intergenic
1110353966 13:74544171-74544193 GTTTCAATGTTGCAGCATGAAGG + Intergenic
1114596146 14:23913866-23913888 GTTACCATCTCTAAGCATGAAGG + Intergenic
1115614383 14:35079803-35079825 GCTAGAATGTAGAGGCATGAAGG + Intronic
1116337270 14:43673003-43673025 GTTACTATGTAGAAGGCTCTAGG + Intergenic
1117905552 14:60581996-60582018 ATTACTATGTAGAAGCCTGCGGG - Intergenic
1120660868 14:87249705-87249727 GTGATTATGTAGGGGCATGAAGG + Intergenic
1134852906 16:17496304-17496326 GAGCCTATGTAGAAACATGAGGG + Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1151505388 17:74523792-74523814 GTGACTCAGTAGAAGCATGAGGG - Intronic
1153162463 18:2223029-2223051 GTGACTCAGAAGAAGCATGAGGG + Intergenic
1153649129 18:7223965-7223987 GTTCTTATGTGGAAACATGAAGG + Intergenic
1155005640 18:21726799-21726821 GTATCTATGTAGAAGCATGTGGG - Intronic
1156037891 18:32786032-32786054 GTAACTATGCAGATTCATGATGG + Intergenic
1157989414 18:52477139-52477161 GTTATTATGTAGAGACATGGTGG + Intronic
1159015574 18:63099531-63099553 TTTATTATTTAGATGCATGAGGG + Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1167537237 19:50061932-50061954 GTAAATATGAAGATGCATGATGG + Intergenic
925825988 2:7849084-7849106 ATTACTATGGAGAAGGATGAAGG - Intergenic
925887576 2:8406167-8406189 GTTACTTTTTAGAAGCAGGCAGG + Intergenic
927684670 2:25161983-25162005 GTTGCCAGGCAGAAGCATGAAGG - Intronic
929347232 2:40899672-40899694 ATTACTAAGGAGAAGCATCAGGG - Intergenic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
930933804 2:56921175-56921197 GCTACGATGTAGAAGTATGTAGG + Intergenic
933790414 2:85879525-85879547 GCTATTATGTAAAAGCTTGATGG - Intronic
937151365 2:119688665-119688687 GTGACTGTGTGTAAGCATGAAGG + Intergenic
937918397 2:127112343-127112365 GTAAATATCAAGAAGCATGATGG + Intergenic
938182902 2:129199732-129199754 ATTACTAAGAAGAAACATGAGGG - Intergenic
943851660 2:192730812-192730834 ATTAATAAGTAGAAGCATGAAGG + Intergenic
946550519 2:220796559-220796581 GATACAATGAAGAAACATGAAGG + Intergenic
1169981707 20:11392213-11392235 CTTATAATGTAGAAGCAAGAAGG + Intergenic
1170258792 20:14378680-14378702 CTTCTTGTGTAGAAGCATGAAGG + Intronic
1173282275 20:41639710-41639732 GATACTTTGGAGAAGCATAAAGG + Intergenic
1177525977 21:22290108-22290130 TTTACTAAAAAGAAGCATGAGGG + Intergenic
1178422620 21:32454368-32454390 GGTACTATGTAGTAGAAGGAAGG - Intronic
1178740058 21:35191115-35191137 GTTAAACTGTATAAGCATGAAGG + Intronic
1182225460 22:28794643-28794665 TTTACTATGTAAATGCTTGATGG - Exonic
950757066 3:15183619-15183641 ATTACGATGGAGAAGCCTGATGG + Intergenic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
957657810 3:83104130-83104152 ATTACTAAGAAGAAGCATCATGG - Intergenic
965459713 3:168946923-168946945 GTTACTATGTAGCGGCATCTAGG + Intergenic
965485489 3:169273411-169273433 ATTTCTATGTGGAAGCATGATGG - Intronic
965714309 3:171586377-171586399 TTTAAAATGTAGAAGCTTGAAGG - Intergenic
971665834 4:29483221-29483243 ATTATTATGTAGAAACATTAAGG - Intergenic
974621891 4:64366879-64366901 GTTACTATGTATATGCCTGAAGG + Intronic
977239692 4:94553071-94553093 GTTAGTATTTAGAAACATAAAGG - Intronic
979857077 4:125647110-125647132 GTGACTATGTATAAGCATTAAGG + Intergenic
981024289 4:140061006-140061028 GTTACCATGAAGAAATATGATGG + Intronic
981487497 4:145302464-145302486 GTTACTTTGTAGAGGCACTAAGG + Intergenic
984289531 4:177777640-177777662 GTTACTTTATAGAAGCATGGGGG + Intronic
987466727 5:18280670-18280692 GTAAATGTGCAGAAGCATGATGG + Intergenic
988282018 5:29161691-29161713 GACACTAAGTAGTAGCATGAAGG - Intergenic
990276400 5:54201600-54201622 ATTACTAAGAAGAAGCATAAGGG - Intronic
993395878 5:87387827-87387849 GTTCACATATAGAAGCATGATGG - Intronic
994034814 5:95186353-95186375 GTTAGTATATAGAAATATGATGG - Intronic
994544274 5:101143344-101143366 GTTACTATTTAAAAGCAAGAAGG + Intergenic
994706520 5:103213380-103213402 ATTACTATATAGAAACATGGTGG - Intergenic
998528579 5:142864481-142864503 GTAAATTTGTAGAAGCATTAGGG + Intronic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
1005814497 6:29539765-29539787 CTTTCTTTGTAGAATCATGAGGG + Intergenic
1008805056 6:55416908-55416930 GTTAATATGCATAAGCATGCGGG - Intergenic
1010516780 6:76782823-76782845 GTGTCTTGGTAGAAGCATGATGG - Intergenic
1011650507 6:89502136-89502158 GTTGCTATGAAGAAACATGGTGG - Intronic
1012506850 6:99956654-99956676 TGGACTATGTTGAAGCATGAGGG + Intronic
1013581106 6:111535591-111535613 GATACTCTGTAGAAGCATCCAGG - Intergenic
1013932710 6:115553882-115553904 CTTACTATGTGAAAGCATCATGG + Intergenic
1017803530 6:157922038-157922060 CTTACAATGTAACAGCATGATGG + Intronic
1019866755 7:3718955-3718977 GTTATTATATAGAAACGTGATGG - Intronic
1022629128 7:32069194-32069216 GTTTCTAAGGAGAAGCATTAAGG - Intronic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1025025331 7:55512064-55512086 GCTACTATCAAAAAGCATGAGGG + Intronic
1030913109 7:115277520-115277542 GTAACTGTGTAGAAGAATGTGGG + Intergenic
1031826821 7:126575935-126575957 GTTACTAACAAGAAACATGATGG + Intronic
1033231269 7:139600059-139600081 GTTACTAAGAGGAAGCATCAGGG - Intronic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1036007210 8:4679284-4679306 CTTACTCTGCAGATGCATGAAGG + Intronic
1036296252 8:7540603-7540625 GTCACTATGTGGAAGATTGATGG + Intronic
1036326314 8:7780416-7780438 GTCACTATGTGGAAGATTGATGG - Intronic
1037000491 8:13712007-13712029 GTTTCTAAGTAAAATCATGACGG - Intergenic
1039621901 8:39005095-39005117 GTTCCCATGTAAAAGGATGAGGG - Intronic
1041687348 8:60656677-60656699 GGTACAATGGAGGAGCATGAGGG - Intergenic
1045690329 8:104753708-104753730 GTTACTAGGTGGATGCAGGAGGG + Intronic
1047058294 8:121192862-121192884 ACTACTATGTAGAAGAGTGAAGG + Intergenic
1049987098 9:961655-961677 TTTACTATGTAATAGCCTGAAGG - Intronic
1051684193 9:19640000-19640022 GTTACTATGCTGAAGCATGAAGG - Intronic
1053332570 9:37228235-37228257 TTTATTATGAAAAAGCATGAAGG + Intronic
1054899204 9:70349912-70349934 GTTACTATCTAAAAGCTTTAAGG - Intronic
1055532558 9:77199772-77199794 TAGACTATGTAGAAGAATGAAGG + Intronic
1058686574 9:107486657-107486679 TTTGCTATGCAAAAGCATGATGG - Intronic
1060666010 9:125432687-125432709 GCTACTATGTGGAGGCAGGAAGG + Intergenic
1061439576 9:130591514-130591536 GGTAGTATGTGGAAGAATGAAGG + Intronic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1186095313 X:6094835-6094857 GTTTCTGTATTGAAGCATGAAGG + Intronic
1188847987 X:35097684-35097706 GTTTCTGTGTAGAAGTGTGATGG - Intergenic
1189998462 X:46661854-46661876 GTCACTTTGGTGAAGCATGACGG - Intronic
1191014694 X:55796190-55796212 GTTACCATGTTGTACCATGATGG - Intergenic
1194774933 X:97951335-97951357 GTTACTATATCCAACCATGATGG - Intergenic
1196139922 X:112249936-112249958 GTGACTATGTAGAAGAAAGGTGG - Intergenic
1199092676 X:143710422-143710444 GTTAGTATATAGAAGTGTGATGG - Intergenic
1199290286 X:146097373-146097395 GGTACTCAGTAGAAGCAGGAGGG + Intergenic