ID: 953138621

View in Genome Browser
Species Human (GRCh38)
Location 3:40206114-40206136
Sequence GCTGATATGGAGTCCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953138621 Original CRISPR GCTGATATGGAGTCCATGGA TGG (reversed) Intronic
904627356 1:31814573-31814595 GCTGACCTGGAGTCCTTGGGAGG - Exonic
905373057 1:37496912-37496934 TCTGATATGAAATCCATTGAAGG - Intronic
906318571 1:44803275-44803297 GCTGATAGGGAGTCGATCGGGGG - Exonic
908351055 1:63286565-63286587 GCTGATCTGGAGTCTAGGGCGGG - Intergenic
912166196 1:107045053-107045075 GCTGAACAGGAGCCCATGGAGGG - Intergenic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
913281581 1:117190104-117190126 GCTGATCTGCAGTCCAAAGATGG - Intronic
921108335 1:212007027-212007049 GATGTTATGGAGTACATGGCTGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923851235 1:237797453-237797475 GTTGAAATTGAGACCATGGAAGG + Intronic
1064968222 10:21036675-21036697 GCTTATATGGAGTAAAAGGAGGG - Intronic
1067577812 10:47419150-47419172 GCAGAGATGGAGTCCAGGGCGGG + Intergenic
1070468507 10:76750690-76750712 GCTCTTATGGAGTCCATTGAAGG - Intergenic
1072530879 10:96317729-96317751 GCAGATATGGTGTCCAGTGAAGG - Intronic
1074761245 10:116669021-116669043 GCAGACATGGAGTCCAAGGAGGG + Intronic
1077373348 11:2193856-2193878 GCTGCTATGAACCCCATGGAGGG + Intergenic
1083231375 11:61322615-61322637 GCTGACCTAGAGTCCATGGATGG + Intronic
1084633769 11:70375911-70375933 TCTAATGTGGAGTCAATGGATGG - Intronic
1086932706 11:92709770-92709792 GCTGATATGCAGAACAGGGAAGG + Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1096597186 12:52703273-52703295 GTGGATATGGGATCCATGGAAGG - Exonic
1097285916 12:57877162-57877184 GGTGATGTGGAGTCTGTGGAGGG + Intergenic
1099937223 12:89141134-89141156 CTTAATATGGTGTCCATGGAAGG - Intergenic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1106319915 13:28627562-28627584 GCTGTTGTGGAGTACATGGCTGG - Intergenic
1113213411 13:108009386-108009408 GCTGATATACAATCCATGGTTGG + Intergenic
1121350622 14:93170193-93170215 GCTGCACAGGAGTCCATGGAGGG + Intergenic
1121899567 14:97681096-97681118 GCAGAGATGGAGTCCATGCCAGG - Intergenic
1122050618 14:99057364-99057386 GGTGATCTGGGGTCCATGGATGG - Intergenic
1122863841 14:104594712-104594734 GCTGATACAGAGTCCAAGGAAGG - Intronic
1128699032 15:69790458-69790480 GCTGGGATGGAGTCAATGGAGGG + Intergenic
1130832632 15:87616957-87616979 GGTGATATGGAGGTCATGGGAGG + Intergenic
1132779485 16:1614706-1614728 GCCGATGAGGAGTCCCTGGAAGG + Exonic
1136712838 16:32253956-32253978 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136755078 16:32675473-32675495 GCTGCTGTGGAGGCCATGAAAGG + Intronic
1136813035 16:33194896-33194918 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136819511 16:33304976-33304998 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136826074 16:33361511-33361533 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136831140 16:33460282-33460304 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1137935421 16:52630730-52630752 GTTGATATGAAGGCCATGGATGG - Intergenic
1138460723 16:57146214-57146236 GCTGCCATGGAGTTCCTGGATGG + Exonic
1141399427 16:83734069-83734091 CATGATTTGGAGTACATGGATGG - Intronic
1202991613 16_KI270728v1_random:17866-17888 GCTGCTGTGGAGGCCATGAAAGG - Intergenic
1203057220 16_KI270728v1_random:935812-935834 GCTGCTGTGGAGGCCATGAAAGG + Intergenic
1143039597 17:4023982-4024004 ACTGATAGGGAGGTCATGGAGGG - Intronic
1145040202 17:19572266-19572288 GCTGAAATGGGGTCCATGAAAGG - Intronic
1145784047 17:27582711-27582733 GCTGAGAGGGTGTCCGTGGAAGG - Exonic
1148163828 17:45468476-45468498 GCTGGTGTTGAGGCCATGGAGGG + Exonic
1148291271 17:46452479-46452501 TCTAATTTGGATTCCATGGATGG + Intergenic
1148313458 17:46670182-46670204 TCTAATTTGGATTCCATGGATGG + Intronic
1150395058 17:64815130-64815152 GCTGGTGTTGAGGCCATGGAGGG + Intergenic
1153049237 18:885525-885547 GCAGAGATGGAGTCTATGCATGG + Intergenic
1158198602 18:54915526-54915548 GCTGATTTGGTATCCAGGGATGG + Intronic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1164828049 19:31298691-31298713 CATGACATGGAGCCCATGGACGG - Intronic
1165257760 19:34589876-34589898 GCTGCCATGGAGTGCAGGGAAGG + Intergenic
926180039 2:10634407-10634429 GCTGAAATGGAGACCCTGGCAGG + Intronic
928483897 2:31710440-31710462 GGTGGTATACAGTCCATGGAAGG - Intergenic
929347460 2:40903356-40903378 GCTGAGCTGTAGTCCATGAAGGG - Intergenic
930723993 2:54665043-54665065 GCTGATATGGAGATCAGGGCAGG - Intronic
933778376 2:85785496-85785518 GCTGAAGTGGGGTCCAAGGAGGG - Intronic
933852891 2:86385284-86385306 GCTGCTCTGGTGTGCATGGAAGG + Intergenic
935873804 2:107484348-107484370 GCTGATATGCACTGCATGGGAGG - Intergenic
940983289 2:160026484-160026506 GCTGATATGGACTCCAGGTGGGG + Intronic
945874925 2:215268070-215268092 GCTGGGGTGGAGTCCATGGAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170783293 20:19446410-19446432 GCTTAAATGCAATCCATGGATGG - Intronic
1172577395 20:36019705-36019727 GCTGAGATGGAGGGCTTGGAAGG + Intronic
1173723977 20:45284048-45284070 GCTGGTATTGAGTCAAGGGAAGG + Intergenic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1176364965 21:6027207-6027229 GCTGACACTGAGTCCATGGGAGG + Intergenic
1179758553 21:43511338-43511360 GCTGACACTGAGTCCATGGGAGG - Intergenic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
1181640065 22:24191563-24191585 GCTGATCTGGGGGCCAGGGAGGG + Intergenic
1183540863 22:38428569-38428591 GCAGAGATGGAATCCAGGGAGGG - Intronic
1184059923 22:42075239-42075261 GATGATATGGTGATCATGGAAGG + Intronic
949779722 3:7672480-7672502 GCTTTAATGGAGTCTATGGATGG - Intronic
952145894 3:30531507-30531529 GCAGATGGGTAGTCCATGGATGG - Intergenic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
952773210 3:37020902-37020924 GGGGATATGGAGGCCAGGGAAGG - Intronic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
957018967 3:75102036-75102058 GCTTAGCTGGAGCCCATGGAGGG - Intergenic
957488961 3:80898520-80898542 GCAGAAATGGAGGCCATTGATGG - Intergenic
959386016 3:105708095-105708117 GCTGATAAGGAGTCAATTTAGGG - Intronic
962685898 3:137847492-137847514 GCTGATCTGGAGCCCAGGGCAGG - Intergenic
962887063 3:139637615-139637637 GATGATATGGAGTACTTGTAAGG - Intronic
964646499 3:158963678-158963700 GCTGAAATGGGGACCATTGAAGG + Intronic
969098548 4:4752153-4752175 GCAGACATGGAGCCCAGGGAGGG + Intergenic
969651371 4:8470084-8470106 CCTGTTATGGAGTCCATGCTGGG + Intronic
970322570 4:14889459-14889481 TCTGATTTGGAGACCAGGGAAGG - Intergenic
970599558 4:17630474-17630496 GCAGATATGGAGTCTGGGGAGGG - Exonic
970765766 4:19547132-19547154 AATGATATGCAGTCCATGGGGGG - Intergenic
971820971 4:31554946-31554968 GATGAAATGGTGTGCATGGATGG + Intergenic
972985800 4:44763124-44763146 GATGATCTGGAGTACAAGGAAGG + Intergenic
974061231 4:57037943-57037965 GCAGAAATGCAGTCCGTGGATGG - Intronic
984192796 4:176625240-176625262 GCCGCAAAGGAGTCCATGGAGGG + Intergenic
988790018 5:34599119-34599141 GCAGATATGGAGGGCAGGGAGGG + Intergenic
990718966 5:58671616-58671638 GCTGATATGGAGACATGGGAAGG - Intronic
990795786 5:59538987-59539009 GGTGATGTGGAGTTCATGAATGG - Intronic
992356257 5:75987025-75987047 GTTGATATGGAGAGCATGGTGGG - Intergenic
993420998 5:87700840-87700862 CCTGAGATGGAGCCCATGGCAGG - Intergenic
993970804 5:94417967-94417989 GCTGTTATGGAGCCAAAGGAGGG - Intronic
995693673 5:114856232-114856254 GCTGAAATGGAGTACATGCTTGG + Intergenic
997212503 5:132085760-132085782 GCTGATATGAAGGAGATGGATGG - Intergenic
1005354091 6:24965840-24965862 ACTGAGATGGAGCACATGGAAGG - Intronic
1007661564 6:43489934-43489956 GTTTATATGGAGTGCCTGGAGGG + Intronic
1011237552 6:85234045-85234067 GTTGATATGGAGTCTAAAGAAGG + Intergenic
1011440672 6:87383691-87383713 GATGATATGGAGCACCTGGAAGG + Intronic
1011840879 6:91497499-91497521 GCTGATGTGGAGACCATTTAGGG - Intergenic
1014248379 6:119091898-119091920 GCAGGTATGGAGGCCATGCAAGG - Intronic
1015257811 6:131199737-131199759 GCTGAAATAGCCTCCATGGAAGG - Intronic
1021898300 7:25258170-25258192 GCCGATTTGGAGGCCATGGGTGG + Intergenic
1022743797 7:33149105-33149127 GATGATTTGGAGACCATGGAGGG + Intronic
1030810335 7:113964096-113964118 CCTTATAGGGAGTCCATGCATGG - Intronic
1031310621 7:120192685-120192707 GCAGATTTGGTGTCCAGGGAGGG + Intergenic
1033264373 7:139872227-139872249 GCTGATGTGGAGTACCTGGAGGG - Exonic
1033933051 7:146547915-146547937 GAGGATATGGAGCCCATGCATGG - Intronic
1034218156 7:149423214-149423236 CCTGATAAGGAGTCCAGGGACGG - Intergenic
1034245054 7:149637673-149637695 GCTGCAATGGAGCCCATTGAGGG - Intergenic
1039150937 8:34504756-34504778 GGTGATGTGGAGTAGATGGATGG + Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1041012554 8:53558880-53558902 GCTGAGATGGAGCTCCTGGAGGG + Intergenic
1041919599 8:63167707-63167729 AGTGATACAGAGTCCATGGAAGG - Intergenic
1042864273 8:73343930-73343952 GCTTCTTTAGAGTCCATGGATGG + Intergenic
1044022395 8:87121664-87121686 GCTGATTGGGAGTACAGGGAGGG - Intronic
1044775574 8:95683848-95683870 GCTGATGATGAGTTCATGGATGG + Intergenic
1044965364 8:97568983-97569005 ACTGAGATGGAAGCCATGGAGGG + Intergenic
1045141507 8:99290155-99290177 GCTTATATGTAGTTCATTGATGG + Intronic
1045202582 8:99999717-99999739 GGAGATACTGAGTCCATGGAGGG - Intronic
1046619897 8:116517972-116517994 AGTGAGATGAAGTCCATGGAAGG + Intergenic
1046727303 8:117689772-117689794 GCTCTTATGGAGCCCATGGTAGG - Intergenic
1050147355 9:2583469-2583491 GCTGCTATGGAGGGCATGGTGGG + Intergenic
1050331400 9:4549764-4549786 TATGGTATGGAGTCTATGGAAGG - Intronic
1050575851 9:6994433-6994455 GCACATATGGAGTCTATGGGCGG - Intronic
1052357063 9:27515977-27515999 GCTGATAAGAAGGCCATTGAAGG + Intronic
1055365795 9:75543341-75543363 GTTGATATGGTGTTCAAGGAAGG + Intergenic
1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG + Intergenic
1058043025 9:100325407-100325429 GCTACTTTGGAGTCCAAGGAGGG + Intronic
1059397516 9:114047506-114047528 GCTGATATGGAGGGAAGGGAGGG - Intronic
1060775794 9:126373291-126373313 CCTGTTAGGGAGTCCACGGATGG + Intronic
1061859095 9:133459052-133459074 GCTGAGATGGAGTTCAGCGAGGG + Exonic
1187352717 X:18535822-18535844 GTTGATATGGAGCCATTGGAGGG - Intronic
1189901148 X:45707572-45707594 GCTGCTATGAAGGCCATGCACGG - Intergenic
1193366822 X:80644281-80644303 ACTCAGATGGTGTCCATGGAGGG - Intergenic
1194745154 X:97620298-97620320 GCAGATTTGGAGTCCAATGAGGG + Intergenic
1201596936 Y:15680701-15680723 GCTGGTGTTGAGTCCATGGAAGG + Intergenic