ID: 953145445

View in Genome Browser
Species Human (GRCh38)
Location 3:40270662-40270684
Sequence TGCCCACAACTCTCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953145441_953145445 10 Left 953145441 3:40270629-40270651 CCCAAGTCCCACAGCTCTCACAC No data
Right 953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG No data
953145444_953145445 2 Left 953145444 3:40270637-40270659 CCACAGCTCTCACACATTAGTCT No data
Right 953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG No data
953145440_953145445 16 Left 953145440 3:40270623-40270645 CCATGTCCCAAGTCCCACAGCTC No data
Right 953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG No data
953145443_953145445 3 Left 953145443 3:40270636-40270658 CCCACAGCTCTCACACATTAGTC No data
Right 953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG No data
953145442_953145445 9 Left 953145442 3:40270630-40270652 CCAAGTCCCACAGCTCTCACACA No data
Right 953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953145445 Original CRISPR TGCCCACAACTCTCCCAGAC TGG Intergenic
No off target data available for this crispr