ID: 953146404

View in Genome Browser
Species Human (GRCh38)
Location 3:40279828-40279850
Sequence GACTTCCCATTTGAGATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953146402_953146404 7 Left 953146402 3:40279798-40279820 CCTAGGAAGTGCAGTAAGAAGTA No data
Right 953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953146404 Original CRISPR GACTTCCCATTTGAGATTTG TGG Intergenic
No off target data available for this crispr