ID: 953146551

View in Genome Browser
Species Human (GRCh38)
Location 3:40281371-40281393
Sequence CTGCTGTTTTGGAGGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953146551_953146555 30 Left 953146551 3:40281371-40281393 CCTTTGTTCCTCCAAAACAGCAG No data
Right 953146555 3:40281424-40281446 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953146551 Original CRISPR CTGCTGTTTTGGAGGAACAA AGG (reversed) Intergenic
No off target data available for this crispr