ID: 953151119

View in Genome Browser
Species Human (GRCh38)
Location 3:40325980-40326002
Sequence GGGCTTCAGGTTAAAACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953151119_953151125 6 Left 953151119 3:40325980-40326002 CCTCAGGTTTTAACCTGAAGCCC No data
Right 953151125 3:40326009-40326031 GTAGGTTAGCCCAGTAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953151119 Original CRISPR GGGCTTCAGGTTAAAACCTG AGG (reversed) Intergenic
No off target data available for this crispr