ID: 953166031

View in Genome Browser
Species Human (GRCh38)
Location 3:40465695-40465717
Sequence CCTCATGGACTGTAGCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953166031_953166037 4 Left 953166031 3:40465695-40465717 CCCTTTGGCTACAGTCCATGAGG 0: 1
1: 0
2: 0
3: 10
4: 122
Right 953166037 3:40465722-40465744 CAGAGGATGAGAAAGCTTCAGGG 0: 1
1: 0
2: 1
3: 33
4: 345
953166031_953166036 3 Left 953166031 3:40465695-40465717 CCCTTTGGCTACAGTCCATGAGG 0: 1
1: 0
2: 0
3: 10
4: 122
Right 953166036 3:40465721-40465743 TCAGAGGATGAGAAAGCTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953166031 Original CRISPR CCTCATGGACTGTAGCCAAA GGG (reversed) Intergenic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902100436 1:13983416-13983438 CCTCATTGCCTGGAGCCAACAGG + Intergenic
903387271 1:22935661-22935683 CTTCATAGGCTGTAGCCAATTGG + Intergenic
904623354 1:31788772-31788794 GCTCGTGGACTGGGGCCAAAAGG + Intergenic
907971731 1:59389511-59389533 CATCATTGACAATAGCCAAAAGG - Intronic
908003769 1:59707780-59707802 CATCATGGACTCTTGACAAATGG + Intronic
908734382 1:67260551-67260573 CCTTATGGATTGTGGCCATAAGG - Intergenic
912073778 1:105846953-105846975 CCTGATGGACTGTAGAGAGAAGG - Intergenic
917276201 1:173334486-173334508 CCTTATGTTCTGTAGCCACAGGG + Intergenic
919426311 1:197435866-197435888 TCTCATGAACTGTAGCCCCAGGG + Intronic
920175231 1:204097055-204097077 CTTGATGGACTGGAGACAAAGGG - Intronic
920191877 1:204199000-204199022 CCTCATGGGCTCTTGTCAAATGG + Intronic
922337498 1:224629568-224629590 CATTATCCACTGTAGCCAAAAGG - Intronic
1067039057 10:42939166-42939188 CCTCATGGACGGTGGCAAAGTGG + Intergenic
1070921546 10:80189830-80189852 CCTCATTCACAGTAGTCAAAAGG + Intronic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1071518376 10:86314186-86314208 CCTCAGATACTGTAGCCAAGAGG + Intronic
1071937763 10:90549852-90549874 ATTCATGGGCTGTAGCCAATGGG + Intergenic
1072793217 10:98334328-98334350 CCTCAGTGATTGTTGCCAAATGG + Intergenic
1073444161 10:103571008-103571030 CCTCATGGACCTCAGCCACAAGG + Exonic
1074271020 10:111953335-111953357 CCTCTGGAACTGCAGCCAAATGG + Intergenic
1079485704 11:20934117-20934139 CCTCTTGATCTATAGCCAAAAGG - Intronic
1084889714 11:72230704-72230726 CCTCATGGACATGAGCCAACTGG + Intronic
1085590812 11:77758380-77758402 CATTATTCACTGTAGCCAAAAGG - Intronic
1087773547 11:102237076-102237098 CCTCATGGGCTGTAGCCCAGTGG + Intergenic
1088278724 11:108116011-108116033 CTTCATGGGCTGTGGCCAATTGG + Intergenic
1091362021 11:134985482-134985504 CTTCATGGGGTGTAGCCAATTGG - Intergenic
1093147423 12:15583137-15583159 GCTCATGGGCTTTATCCAAAAGG - Intronic
1099817811 12:87670598-87670620 CTTCATGGGGTGTAGCCAATTGG - Intergenic
1106563638 13:30867503-30867525 CAGCATGGACTGTGGCCAACTGG + Intergenic
1111551225 13:89816031-89816053 CCTCATGGTTGGCAGCCAAAGGG - Intergenic
1111960046 13:94800227-94800249 CTTCCTGAACTGCAGCCAAAGGG - Intergenic
1112008009 13:95270792-95270814 CCTCATAGATGGTGGCCAAATGG + Intronic
1112374981 13:98830741-98830763 CCTCATGGAGTGTAGTCTAATGG - Intronic
1112484405 13:99807401-99807423 CATTATTCACTGTAGCCAAAAGG + Intronic
1112585284 13:100713546-100713568 CCTTATTCACAGTAGCCAAAAGG - Intergenic
1114204206 14:20553100-20553122 CATCATTTACAGTAGCCAAATGG + Intergenic
1115085461 14:29509709-29509731 CTTCATGGACTGAAGCCATGTGG + Intergenic
1119082040 14:71704040-71704062 CCTCTTGTACTGTAGTGAAAAGG - Intronic
1121692211 14:95886037-95886059 CATCGTGGACTCTAGCCAACAGG + Intergenic
1122925121 14:104895891-104895913 CCTGATGGCGTGAAGCCAAAAGG - Exonic
1124566661 15:30821800-30821822 CCTCACTGACTGTTGACAAATGG - Intergenic
1126131587 15:45347218-45347240 TCTCATGGTATGTAGCAAAACGG - Intergenic
1132952696 16:2573143-2573165 CATCATGCACAGTAGCCAAAAGG + Intronic
1132961655 16:2627027-2627049 CATCATGCACAGTAGCCAAAAGG - Intergenic
1134790321 16:16983746-16983768 CTTCATGGGGTGTAGCCAACTGG + Intergenic
1135399372 16:22155695-22155717 CTGCATGGGCTGTAGCCACATGG - Intronic
1136576703 16:31129551-31129573 CCTCCTGGAGTGCAGCCAAGTGG + Intronic
1136949455 16:34697992-34698014 CATCATCGAATGTAACCAAAAGG - Intergenic
1137095036 16:36243810-36243832 CATCATCGAATGTAACCAAATGG - Intergenic
1137222042 16:46464614-46464636 CATCATGGAGTGGAACCAAATGG + Intergenic
1138155290 16:54697254-54697276 ACTGATGGAGTGTAGGCAAACGG - Intergenic
1138336322 16:56256255-56256277 CCCCCTGCCCTGTAGCCAAAGGG - Intronic
1144582660 17:16468271-16468293 CATCATTCACAGTAGCCAAAAGG + Intronic
1147316179 17:39621521-39621543 CCTAATGGGCTGCAGCCCAAGGG - Intergenic
1149290535 17:55213957-55213979 CTTCCTGGAATGTATCCAAAAGG + Intergenic
1203186255 17_KI270729v1_random:123900-123922 AATCATCGACTGGAGCCAAATGG - Intergenic
1153004114 18:482091-482113 CCTCCTGGACAGTAGCCACTGGG - Intronic
1154502232 18:15002684-15002706 CCTCATGGGCTGTGGGCTAAGGG + Intergenic
1157033457 18:43942342-43942364 TCTCATGGACTTTTGCCAGAAGG - Intergenic
926031549 2:9594884-9594906 TCTCAAGGACTGTGGACAAAGGG + Intronic
930855448 2:56011720-56011742 CCTTATTGACAGCAGCCAAAAGG + Intergenic
931500935 2:62865543-62865565 TGTCATGGTCTGTAGCCACATGG - Intronic
934253986 2:90391460-90391482 CATCATTGAATGTAGTCAAATGG + Intergenic
935105522 2:100039789-100039811 CCTCAGGGACTGTTTCCAAGAGG - Intronic
937327262 2:120998054-120998076 GGTCATGCACTGTAGCCCAAAGG + Intergenic
938501406 2:131832856-131832878 CCTCATGGGCTGTGGGCTAAGGG + Intergenic
938754672 2:134368805-134368827 GCTCCTGGGCTGTAGCCACAAGG + Intronic
944436299 2:199694061-199694083 CCTCTGGGACTGCAGCCAAAAGG + Intergenic
947133357 2:226952773-226952795 CCTCAGGGAATGTGGTCAAATGG + Intronic
947179060 2:227396160-227396182 TCTCAAGGACTGAAGCAAAAGGG + Intergenic
948455709 2:238103746-238103768 CCTCATGGAATGTGCCCCAAAGG - Intronic
1171095083 20:22325158-22325180 CTTCATGGACTCTACCCACAGGG + Intergenic
1174506071 20:51018392-51018414 CCTGATGGAATGTAGCCATGGGG - Intronic
1175040843 20:56049418-56049440 CTTCAGGGACTGTAGACTAATGG + Intergenic
1178514670 21:33236516-33236538 CCCCATGGACTGGAGTCAGAGGG - Intronic
1180957205 22:19746390-19746412 CCTGCAGGATTGTAGCCAAAAGG - Intergenic
950238900 3:11350179-11350201 CCTCAGGGACTCTAGTGAAATGG - Intronic
952190109 3:31014157-31014179 CCTCATGGACTGCAGTTAAATGG - Intergenic
953166031 3:40465695-40465717 CCTCATGGACTGTAGCCAAAGGG - Intergenic
976302641 4:83529895-83529917 CCTCATCTCCTGTAGCCACATGG + Intergenic
976324342 4:83753475-83753497 CCTCAGGGGCTGTAGATAAAAGG + Intergenic
978418242 4:108502044-108502066 TCTCAGGGGTTGTAGCCAAAAGG + Intergenic
983094273 4:163543273-163543295 CCACATGGATGGTAGCCATAGGG + Intronic
983197264 4:164821050-164821072 CCTCATGGACTGGAACCCAAAGG + Intergenic
984087537 4:175331183-175331205 TCTCATTCACTGTAGCCAGAGGG + Intergenic
985657348 5:1139179-1139201 CCTCATGGTCCGTAGGCAAGAGG + Intergenic
987525603 5:19045468-19045490 CCTCATGGCCGGGGGCCAAATGG + Intergenic
987827013 5:23045123-23045145 ACTCATGGAATGTAACGAAAAGG + Intergenic
988629771 5:32916609-32916631 CCTAATGGAATGTAGCCTATGGG - Intergenic
989049159 5:37301772-37301794 CTTCCAAGACTGTAGCCAAATGG + Intronic
990317955 5:54601820-54601842 CCTCATGGACTGAAGCAGACAGG - Intergenic
995922758 5:117333159-117333181 CTGCATGATCTGTAGCCAAAGGG - Intergenic
996139244 5:119885626-119885648 CCTCAAAGACTGTAGCCTAAAGG - Intergenic
998253176 5:140566248-140566270 CCCCAACTACTGTAGCCAAATGG - Intronic
998329244 5:141309258-141309280 CATCATGAACTGTAGCCCAGTGG - Intergenic
1002100065 5:176853204-176853226 CACCAAGGACTTTAGCCAAATGG - Intronic
1002357507 5:178642641-178642663 CCACTTGGACTGCAGCCAAAGGG + Intergenic
1008322150 6:50129280-50129302 CCTCATGGAAAGTAGCCTATTGG - Intergenic
1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG + Intronic
1011376040 6:86687884-86687906 CCTCAAGTACTGTAGACAACAGG - Intergenic
1013065486 6:106680793-106680815 CTTCATAGACTGGAGCCAAGTGG + Intergenic
1013610369 6:111788950-111788972 CCTGTTGGAGTGTAGCCAGAAGG - Intronic
1013817406 6:114115375-114115397 ACTCATGTAATTTAGCCAAAAGG - Intronic
1014754780 6:125291072-125291094 CCTCATGTATTGTCGCCTAAGGG - Intronic
1015443545 6:133276032-133276054 CAGCATGGACTCTAGCAAAATGG + Intronic
1015651359 6:135464665-135464687 CCACATGGACTGTCTCCATATGG - Intronic
1021439643 7:20663308-20663330 CATCATCTACAGTAGCCAAAAGG + Intronic
1022838101 7:34136092-34136114 CAGCATGGACAGTAGCCACAGGG + Intronic
1022841446 7:34167987-34168009 CCTCAAAGACTGTGGCCATAGGG + Intergenic
1023192931 7:37602194-37602216 CCTGATGGACTGTGGCCACCTGG + Intergenic
1024011174 7:45268211-45268233 CCACACGGTCTGCAGCCAAATGG + Intergenic
1025475642 7:60917223-60917245 CTTCATGGAATGTAATCAAATGG - Intergenic
1025484304 7:61027307-61027329 CCTCATTGAATGTAATCAAATGG - Intergenic
1028754725 7:94421977-94421999 CTTCATTTACTCTAGCCAAAAGG + Intronic
1036204006 8:6792205-6792227 CTTCATGGGGTGTAGCCAATTGG - Intergenic
1037625379 8:20601819-20601841 CCCCATAGACTAGAGCCAAATGG + Intergenic
1038313493 8:26463754-26463776 CCTCATTCACAATAGCCAAAAGG - Intronic
1038804169 8:30775508-30775530 CTTCATGGGGTGTAGCCAATTGG - Intronic
1039167848 8:34706307-34706329 CCTCATGCACTGTAAGCAGAAGG - Intergenic
1050124247 9:2339960-2339982 CCTCAGGCAGTGGAGCCAAACGG - Intergenic
1051420445 9:16883864-16883886 CCTCATCAACTGTATCAAAATGG - Intergenic
1052647808 9:31259928-31259950 CCTCATGCTGTGTAGCCACATGG - Intergenic
1054860641 9:69949282-69949304 TCTCAGGGACTGTGGCCAAAGGG + Intergenic
1058019973 9:100076628-100076650 ATTCATGGGCTGTAGCCAATGGG + Intronic
1060158061 9:121334018-121334040 CCTTATGCACAATAGCCAAAAGG - Intergenic
1061540022 9:131273233-131273255 CCTCATGGACGGACACCAAACGG + Intronic
1062498249 9:136841664-136841686 CCTCATGGGCTGTGGGCTAAGGG - Intronic
1186489841 X:9962858-9962880 GCTCATTCACAGTAGCCAAAAGG - Intergenic
1193781055 X:85701723-85701745 CTTCATAGAATGTAGCCCAAGGG - Intergenic
1194273336 X:91848065-91848087 TCACATGGCCTGTAGACAAATGG - Intronic
1201217795 Y:11738332-11738354 ACTAATGGACTGTAACAAAATGG + Intergenic
1202115799 Y:21468111-21468133 CCTAATGGACTGCACTCAAAGGG - Intergenic