ID: 953170276

View in Genome Browser
Species Human (GRCh38)
Location 3:40500862-40500884
Sequence CAGGGTAAATTCTCTGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953170276_953170281 27 Left 953170276 3:40500862-40500884 CCAACATCAGAGAATTTACCCTG No data
Right 953170281 3:40500912-40500934 GTAGAAAAGCCTTTAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953170276 Original CRISPR CAGGGTAAATTCTCTGATGT TGG (reversed) Intergenic
No off target data available for this crispr