ID: 953173142

View in Genome Browser
Species Human (GRCh38)
Location 3:40525349-40525371
Sequence TCCCAGTGGGTGATGCTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953173142 Original CRISPR TCCCAGTGGGTGATGCTGAC CGG (reversed) Intronic
902680270 1:18038793-18038815 TCTCCTTGGATGATGCTGACTGG - Intergenic
902818698 1:18930504-18930526 TTTCAGTGGGTTTTGCTGACGGG - Intronic
902989291 1:20175006-20175028 TCCCCGTGGATGACACTGACAGG - Exonic
904894743 1:33806198-33806220 TCCCAGAGGGTGGTAGTGACAGG - Intronic
906557748 1:46728073-46728095 TCTCACTGGGAGATGCAGACCGG - Intergenic
907527298 1:55061371-55061393 TCCCAGTGGGAGCTGCAGCCTGG - Exonic
907765745 1:57408908-57408930 TCCCAGTGAGTGAATCTAACTGG - Intronic
908292900 1:62686558-62686580 TCCCAGGGAGTTATGATGACAGG - Intronic
910261432 1:85297131-85297153 TCTGAGGGGGTGATGCTGAATGG + Intergenic
915491453 1:156252134-156252156 CCCCAGTGGGTGCTGATCACAGG + Intronic
920064348 1:203256515-203256537 TCACACTGGGAGATGCAGACCGG - Intronic
921918561 1:220641649-220641671 TCTCGGTGGGAGATGCAGACAGG - Intronic
924438159 1:244063861-244063883 TTCCAGTAGATGATGCTGAGAGG - Intergenic
1066034574 10:31468351-31468373 GGCCAGTAGGTGATGCTGGCAGG - Intronic
1069493110 10:68878506-68878528 TCCCACTGGGTGATTCTCAGAGG - Intronic
1069619619 10:69828778-69828800 TCCCAGTGGGTGGTTTTGCCTGG - Intronic
1071235832 10:83647046-83647068 TGCCAGTGGGGGATGATGAGGGG + Intergenic
1072118365 10:92385035-92385057 TCCCAGGTGATGATGCTGGCTGG - Intergenic
1075978239 10:126715426-126715448 TTGCAGTGGCTGATGCTTACGGG + Intergenic
1080660353 11:34291286-34291308 TCCCAGTGGGAGAGGCTGGCTGG - Intronic
1080785086 11:35467847-35467869 TCCCAGTGAGTGATTCTCAGAGG - Intronic
1084218869 11:67665896-67665918 TCCCAGTGGGTGAGCCAGACCGG - Intronic
1084419141 11:69051673-69051695 CCCCAGTGGGTGATGGTGTGTGG + Intronic
1089203378 11:116739133-116739155 TACCTGTGGGTGATGCAGAGAGG - Intergenic
1091395036 12:149212-149234 TCTCAGGAGGTGCTGCTGACGGG - Intronic
1091641532 12:2240903-2240925 TCTCAGTGGGTGCTTCTGCCAGG + Intronic
1094111231 12:26864902-26864924 TCCCAGAGGGTTATGCTGCTGGG - Intergenic
1097189942 12:57214803-57214825 GCGGAGTGGGGGATGCTGACTGG - Intergenic
1101446736 12:104742316-104742338 TCCCAGAGGGTGATGCTCTTGGG - Intronic
1102331434 12:112035099-112035121 TCCCAGTGGTTATTACTGACTGG + Intronic
1102641272 12:114368914-114368936 CCCCAGGGGGAGATTCTGACTGG - Intronic
1103339208 12:120212261-120212283 TCGCAGTTGGGGATGCTGGCTGG + Exonic
1103592290 12:122000720-122000742 TCCAAGTGGGTGGTTCTGAGAGG + Intronic
1104534600 12:129607288-129607310 TCCCAGTGGGTCACGCAGAGTGG + Intronic
1106326409 13:28694291-28694313 TCCCACTGGGAGCTGCAGACTGG + Intergenic
1107564711 13:41590102-41590124 TCCCAGTGGGTTCTGCTCATGGG + Intronic
1108391913 13:49955320-49955342 TCCCAGTGGTTGTTGCTGGGAGG + Intergenic
1112807729 13:103181378-103181400 TGCCAGTTGGTGATTCTGCCAGG + Intergenic
1113128137 13:107003450-107003472 TCCTAGTGGGTGAGGCAAACAGG - Intergenic
1113319499 13:109220187-109220209 TCACTATGGGTGATGGTGACTGG + Intergenic
1113435104 13:110285322-110285344 TCCCAGTGAGTGAGGCCCACAGG - Intronic
1113878199 13:113607747-113607769 TGCCAGTGGGTGGCGGTGACGGG + Intronic
1113920522 13:113906037-113906059 TGCCAGTGGGTGATGATCAGAGG - Intergenic
1115276100 14:31610722-31610744 TCCCAGTTGGTCATGATGAATGG - Intronic
1116494304 14:45542432-45542454 TCCCACTTGGTTATGATGACTGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121816723 14:96934347-96934369 CCCCAGTGAGTGAGGCTCACAGG - Intergenic
1122812897 14:104297758-104297780 TCACAGTGGGTGAGGCTGAGTGG + Intergenic
1123014064 14:105365230-105365252 TCCCCTGGGGTGATGCTGGCCGG - Intronic
1202842775 14_GL000009v2_random:138395-138417 TCCCACTGGGTGTTGCAGACCGG + Intergenic
1202912173 14_GL000194v1_random:128637-128659 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1123725719 15:23099548-23099570 TCCAAATGGCTGATGCTGCCAGG - Intergenic
1126682887 15:51220360-51220382 TTCCAGTGAGTGATGTGGACAGG - Intronic
1127785633 15:62352377-62352399 AACTAGTGGGTGATCCTGACAGG + Intergenic
1127844482 15:62857273-62857295 ACCCTGTGGGTGATTCTGACTGG - Intergenic
1129682096 15:77663759-77663781 TCCCAGGGGCTGAAGCTGAAGGG + Intronic
1130761966 15:86830630-86830652 GCCCAGTGTATGTTGCTGACAGG - Intronic
1130978760 15:88797888-88797910 ACTCAGTGAGTGATGCTGAGTGG - Intergenic
1134340472 16:13340536-13340558 CCCCAGAGGGTGAATCTGACTGG - Intergenic
1135303562 16:21350612-21350634 TCCCAGTGGGTTATTCTGAGAGG + Intergenic
1135807454 16:25555873-25555895 TCTCACTGGGAGCTGCTGACCGG - Intergenic
1136300307 16:29329806-29329828 TCCCAGTGGGTTATCCTGAGAGG + Intergenic
1136613204 16:31379784-31379806 ACCCAGAAGTTGATGCTGACAGG - Exonic
1137619178 16:49865246-49865268 GCCCAGTGAGTGCTGGTGACTGG + Intergenic
1137837356 16:51605619-51605641 TTCCAGTATGTGATGCTGGCTGG + Intergenic
1138520402 16:57567791-57567813 ACCCAGTGGGTAGTGCTGCCTGG + Intronic
1139334630 16:66223207-66223229 TCCCTGGGAGTGATGGTGACAGG + Intergenic
1140507454 16:75482748-75482770 TCTCAGTGGGCGATGTGGACAGG - Intronic
1142062038 16:88036570-88036592 TCCCGGTGGGTTATCCTGAGAGG + Intronic
1142481939 17:224370-224392 TCCCAGCGGGAGGTGCTGGCAGG - Intronic
1142806236 17:2372564-2372586 TGCCAGTGGGTGCGGTTGACAGG + Intronic
1151974393 17:77476152-77476174 TCCCTGTGTGTCATGCTGCCTGG - Intronic
1152843752 17:82586573-82586595 TCCCAGAGTGTGAGGCTGATGGG - Intronic
1153248891 18:3100622-3100644 TTCCAGGGGGTGATGGTGACGGG + Intronic
1153811208 18:8753505-8753527 GCCCATTGGGTCATGCTTACTGG - Intronic
1155169046 18:23253608-23253630 TCCCAGAGGGTGATCTGGACTGG - Intronic
1155812767 18:30259220-30259242 TCCCAGTGGTGGAAGCGGACTGG + Intergenic
1160707195 19:535196-535218 CCACAGGGGGCGATGCTGACAGG + Intronic
1160776040 19:856144-856166 TCTCAGTGGGTCCTGCTGGCCGG - Exonic
1161710474 19:5844677-5844699 TCCCAGTGGGTCCTCCCGACAGG - Exonic
1162122867 19:8482696-8482718 TCCAAGTGGGTGATGCTGGGCGG + Intronic
1162869923 19:13578527-13578549 GCCAAGTGGGTAATGGTGACTGG - Intronic
1165721719 19:38083582-38083604 TCCCAGTGGGGGATGGTCAGAGG + Intronic
1166133567 19:40762003-40762025 TCCAAGTTGGTGATGGTGTCTGG + Intronic
1166917602 19:46206201-46206223 CAGCAGTGGGTGATGATGACGGG - Intergenic
1167112486 19:47470497-47470519 TCTCAGTGGGGGGTGCTGAGAGG - Intronic
1167810480 19:51825304-51825326 TCCCAGAGGGTGATGCACTCAGG - Exonic
1168244807 19:55106891-55106913 GCCCTGTGCGTGATGCTCACTGG - Intronic
925093305 2:1172776-1172798 TTCCAGGGGGTCATGTTGACAGG + Intronic
926416006 2:12650438-12650460 TCCCTGTGAGAGTTGCTGACAGG - Intergenic
926434877 2:12827603-12827625 TCCCAGTGGGTGTGGGTTACAGG + Intergenic
927321740 2:21755267-21755289 TCCCAATGTGTGAGGATGACAGG - Intergenic
927565810 2:24111758-24111780 TCCCAGTGGGTGAGGATGAGAGG - Intronic
929310818 2:40422054-40422076 TCCCAGTGGAAGGTGCTGAGTGG - Intronic
931246134 2:60494219-60494241 TGAGAGAGGGTGATGCTGACAGG + Intronic
931457240 2:62420881-62420903 TCCCACTTGGTCATGCTGAATGG - Intergenic
931545982 2:63388169-63388191 TCACACTGGGAGATGCAGACTGG - Intronic
933779988 2:85794818-85794840 TCTCCGTGGGAGGTGCTGACAGG - Intergenic
936238422 2:110766693-110766715 TCCCATTGGGTCCTGCTGATGGG + Intronic
937956703 2:127425838-127425860 AGCCAGTGGGTGATGCTGCCTGG + Intronic
941025136 2:160449133-160449155 TCCCAGTGGGGGCGGCTGCCGGG - Intronic
942155318 2:173121753-173121775 TCCCAGGAGGTGATGGTGGCGGG - Intronic
942456601 2:176142469-176142491 GCCCAGTGGGTGTGACTGACAGG - Intergenic
944506435 2:200417197-200417219 TCCCAGTGGGGGAAGATCACAGG + Intronic
945778222 2:214133737-214133759 TCCCAGTGTGAGTTGATGACAGG + Intronic
945842848 2:214908687-214908709 TCCCAGTTTGTGAAGCTGATAGG - Intergenic
946327661 2:218993124-218993146 TCCCAGAGCGTGAGGCTGGCGGG + Exonic
948054327 2:235000112-235000134 TCCCAGTGGCTGTCGCTGCCTGG - Intronic
1169067780 20:2704189-2704211 TCCCAGGGGGTGGGGCTCACTGG + Intronic
1169307158 20:4501911-4501933 TCACAGTGGGAGCTGCAGACGGG + Intergenic
1173789198 20:45816667-45816689 TCTCAGTGAGTGATGGAGACAGG - Intronic
1174451773 20:50625000-50625022 GGCCACTGGGTGATGATGACAGG + Intronic
1176631530 21:9143314-9143336 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1178393462 21:32219209-32219231 TCTCACTGGGTGCTGCAGACTGG - Intergenic
1179129124 21:38618707-38618729 CCACAGAGGGTGATGCTGAGAGG - Intronic
1179269743 21:39841458-39841480 AGCCAGTGGGAGATGCAGACAGG + Intergenic
1179407240 21:41136291-41136313 TCCCAGTGGCTGCTCCAGACAGG - Intergenic
1183499364 22:38169200-38169222 TTCCGGTGGGTGATGCTCAGCGG - Exonic
1183579512 22:38715574-38715596 GCCCAGTGGGGGAGGCAGACAGG - Intronic
1183694594 22:39414510-39414532 TCCCCATGGGTGATGCTTTCAGG - Intronic
1184413426 22:44338586-44338608 TGCCAGTGGGTGAGGCTGGCTGG + Intergenic
1184512367 22:44941218-44941240 TCCCTCTGGGTGTTGCTGACTGG - Intronic
1184565439 22:45289002-45289024 TCCCTGTGGGTGGGGCTCACAGG + Intronic
950005228 3:9687151-9687173 TCCCAGGGAGAGATGCTAACAGG - Intronic
950562084 3:13736793-13736815 TCTCACTGGGAGATGCAGACCGG + Intergenic
953173142 3:40525349-40525371 TCCCAGTGGGTGATGCTGACCGG - Intronic
953219115 3:40951356-40951378 TCTCACTGGGTGCTGCAGACCGG + Intergenic
956483107 3:69692875-69692897 TCCCAGTTGGGGAAACTGACTGG - Intergenic
957002157 3:74899595-74899617 TCCCAGTGGTTGGTTTTGACAGG + Intergenic
959420456 3:106121766-106121788 TCCCAGGGGGTAATGCAGAATGG - Intergenic
961466384 3:127084473-127084495 TTCAAGTAGGTGATGCTGATGGG + Intergenic
961721928 3:128902838-128902860 TCCACCCGGGTGATGCTGACTGG + Intronic
962613157 3:137098031-137098053 TCCCATTGGCTGAACCTGACTGG + Intergenic
962865431 3:139444678-139444700 TGACTGTGAGTGATGCTGACGGG + Intergenic
963213138 3:142716431-142716453 TCCCAGAGGGTCATGCTGTTTGG - Intergenic
963222775 3:142829080-142829102 TCCCAGGGGGTGGAGCTGATAGG + Intronic
964642206 3:158920960-158920982 TCCCAGTGGGTGAGATTGAGGGG + Intergenic
964755583 3:160088488-160088510 TCCAACTGGGTAATGCTGAGAGG - Intergenic
965696459 3:171413501-171413523 AGCCAGTGGGTGATGCTGAGAGG - Intronic
968002010 3:195212562-195212584 GCCCAGGTGGTGATGCTCACTGG - Intronic
968656261 4:1779670-1779692 GCCCAGGGGCTGATGCTGCCTGG - Intergenic
968755657 4:2414608-2414630 CCTCAGTGGGTTATGCTGGCTGG - Intronic
968954820 4:3712879-3712901 TCTCAGTGGAGAATGCTGACTGG + Intergenic
969135322 4:5024681-5024703 TCGCAGAGGGTGGTGCTGGCAGG - Intergenic
969204409 4:5632553-5632575 TATCAGTGGGTCATGCTGTCAGG + Intronic
974602947 4:64110442-64110464 TCCAAATAGTTGATGCTGACTGG - Intergenic
976527960 4:86115441-86115463 TCTCAGTGGGAGCTGCTGACTGG + Intronic
977430964 4:96929678-96929700 TCACTGTGGGTGATGGTGAGTGG - Intergenic
980583741 4:134787014-134787036 TCTCACTGGGAGATGCAGACTGG + Intergenic
980733336 4:136849366-136849388 TCTCACTGGGAGCTGCTGACTGG + Intergenic
985703164 5:1385908-1385930 GCCCTGTGGGTGGTGCTGAGCGG - Intergenic
986003769 5:3650549-3650571 GCCCAGTGAATGAGGCTGACAGG - Intergenic
987090168 5:14503289-14503311 TGCCAGAGGGTGCTGCTGGCTGG - Intronic
987813059 5:22864232-22864254 TCCCAGTGGGAGATAGTTACAGG + Intergenic
991058158 5:62342277-62342299 TCCCAGATTGTGATGGTGACTGG + Intronic
992254990 5:74912178-74912200 TCTCACTGGGAGATGCAGACTGG + Intergenic
993902953 5:93596658-93596680 TCTCTGTGGGTAATGCAGACAGG - Intergenic
994142968 5:96361740-96361762 TCTCGGTGGGAGCTGCTGACAGG + Intergenic
995207973 5:109504114-109504136 TCCCATTGGTGGATGCTAACAGG + Intergenic
996861670 5:128074002-128074024 TTCCAGAGGGTGCTGCTGGCAGG + Intergenic
997838330 5:137215284-137215306 ACCAAGTGGGTGAGGCTGCCTGG - Intronic
999004839 5:147964211-147964233 TCCCAGTGGAGGATACTGGCAGG + Intergenic
999251690 5:150186246-150186268 TCCCAGTGTGAGAGGCTGGCAGG + Intergenic
1002071743 5:176682611-176682633 ACCCAGTGTGTGTGGCTGACGGG - Intergenic
1002923833 6:1593545-1593567 TGCCAGTGGGTGGTGCTGCTGGG - Intergenic
1003016200 6:2469361-2469383 TCCCAGTGGGTGCTGCGGGGAGG + Intergenic
1003046473 6:2737698-2737720 TTTCTGTGGGTGATGCTGTCAGG - Intronic
1003539234 6:7003494-7003516 TCCCTGTGGCTAATGCTAACCGG - Intergenic
1006517248 6:34551862-34551884 TTGCAGTGAGTCATGCTGACGGG + Intronic
1007413134 6:41676533-41676555 ACCCAGTGTGTGATTCTGCCGGG + Intergenic
1007585985 6:42989765-42989787 TCCCAGGGGGTGAGGCAGAAGGG + Intronic
1009458648 6:63887389-63887411 TCTCAGTGGGAGCTGCAGACTGG - Intronic
1009622685 6:66096897-66096919 TCCCAGACGGTGAGGCTGCCGGG + Intergenic
1015730750 6:136345611-136345633 ACCCACTGGGTGCTGCGGACTGG + Intronic
1023503086 7:40871684-40871706 TACCAGAGGGTGAGGCTCACTGG - Intergenic
1023609562 7:41959125-41959147 GCCCAGTGGGAGAGGCAGACAGG - Intergenic
1023664959 7:42513367-42513389 TCCCAGAGGGTACTGCTGAGGGG - Intergenic
1023803038 7:43851327-43851349 GCCCAGTGGGTGTTACTGAGTGG + Intergenic
1024462460 7:49672480-49672502 TCCCACTGGGTGATGATCTCTGG - Intergenic
1024677243 7:51647720-51647742 TCCCAGTGGGAGCTGATGTCAGG - Intergenic
1025662176 7:63562973-63562995 TGCCAGTGGGTGATGAGGGCCGG - Intergenic
1026447574 7:70499000-70499022 TCCCAGGGGCTGCTGGTGACTGG - Intronic
1029209964 7:98899333-98899355 TTTCAGTGGGTGATGCTCAGTGG + Intronic
1031832733 7:126647046-126647068 TCCCAGTGGGTAATGCTGGAAGG + Intronic
1033081520 7:138303314-138303336 TGCCAATGGGAGATACTGACAGG + Intergenic
1033267000 7:139895269-139895291 TTCCAGTGTGTGATGATGACTGG - Intronic
1033465676 7:141587275-141587297 TGACAGTCGGTGATGATGACTGG - Intronic
1035077499 7:156190602-156190624 TCCCAGTGGGCGAGGCTGCGGGG - Intergenic
1035219711 7:157399032-157399054 TCTCAGAGGGTGAGGCTGAACGG + Intronic
1035227137 7:157439847-157439869 TCCCTGGAGGTGATGGTGACGGG - Intergenic
1035446691 7:158948014-158948036 TCCCTGGGGGTGAGGCTGAGGGG - Intronic
1036052995 8:5221019-5221041 TCACAGAGGGAGATGCTGAAGGG + Intergenic
1036616964 8:10395728-10395750 TCCCAGTGTCTGGTGCTGAAAGG - Intronic
1039983525 8:42428759-42428781 TTACAGTGCGTGGTGCTGACTGG + Exonic
1040107831 8:43550234-43550256 TCCCCCTGGGTGATGGGGACAGG - Intergenic
1040110170 8:43563708-43563730 TCCCCCTGGGTGATGGGGACAGG - Intergenic
1041131589 8:54707730-54707752 TCCCTGTCGGTGCTGCAGACTGG + Intergenic
1042885793 8:73548776-73548798 TTACAGTGGATGATGCTCACAGG + Intronic
1044886628 8:96785216-96785238 TCCCAGTGGGGTATTCTCACTGG - Exonic
1045604439 8:103756300-103756322 TCCCACTGGGAGCTGCAGACCGG + Intronic
1047070293 8:121335580-121335602 TCCCAGTTGGTGATAATCACAGG + Intergenic
1048306818 8:133290199-133290221 TCCCACAGGGTGAGGCTGAAGGG + Intronic
1049107680 8:140623987-140624009 TCACAGTGGGTGATGGAGACAGG + Intronic
1049602045 8:143512524-143512546 CCCCAGTCGGTGCTGCTGCCCGG - Intronic
1050771751 9:9209952-9209974 TCCCATGGGGTGATGCAGAAGGG + Intronic
1051368948 9:16341930-16341952 TCCCAGTGGGTGAATCTAACAGG - Intergenic
1054889024 9:70232242-70232264 TCTCAGTGGGAGCTGCAGACCGG - Intergenic
1055319763 9:75071803-75071825 TTCCACTGGGTTCTGCTGACAGG + Intronic
1057170572 9:92960859-92960881 TCCCAGTGGGTGATCCCCCCGGG + Intronic
1057742180 9:97721477-97721499 TCACAGTGGGTGATGGTGTGCGG + Intergenic
1059766318 9:117386972-117386994 TCCCAGAGGGTGTTGGTGGCAGG - Intronic
1060020551 9:120126961-120126983 TACCTGAGGGTGATGCTAACTGG + Intergenic
1061792762 9:133067107-133067129 GCCCTGTGGGTGATGCCGCCAGG + Exonic
1062361642 9:136191034-136191056 TCCCAGTGGGAGAGGCAGACGGG - Intergenic
1062452645 9:136621979-136622001 TCCCTGTGGGGGAAGCTGCCGGG + Intergenic
1203754360 Un_GL000218v1:110918-110940 TCCCACTGGGTGCTGCAGACCGG + Intergenic
1186212560 X:7264838-7264860 TTCTAGAAGGTGATGCTGACAGG + Intronic
1189575208 X:42343779-42343801 TCTCAGTGGGAGCTGCAGACTGG + Intergenic
1190643636 X:52504599-52504621 TCTCACTGGGTGACCCTGACTGG + Intergenic
1190705808 X:53027218-53027240 TCCCAATGGTTGAGGCTGAGGGG - Intergenic
1191138798 X:57094370-57094392 TCTCACTGGGAGATGCAGACTGG - Intergenic
1193645604 X:84065850-84065872 TCTCACTGGGAGCTGCTGACCGG - Intronic
1193909294 X:87281500-87281522 TCTCAGTGGGAGCTGCAGACTGG + Intergenic
1194652505 X:96533002-96533024 TCTCACTGGGAGATGCAGACTGG - Intergenic
1194988484 X:100518305-100518327 TCCCACAGGGTGATGCAGAGGGG - Intergenic
1196308172 X:114128212-114128234 TCTCACTGGGAGATGCAGACCGG + Intergenic
1196759935 X:119191849-119191871 TCCAGGTGGGAGATGATGACAGG + Intergenic
1197645863 X:129015913-129015935 TACCCTTGGGTGATGGTGACTGG - Intergenic
1200322798 X:155207218-155207240 TCCCAGGGAGAGAAGCTGACAGG + Intronic
1201167992 Y:11228566-11228588 TCTCACTGGGTGCTGCAGACCGG + Intergenic