ID: 953173501

View in Genome Browser
Species Human (GRCh38)
Location 3:40528631-40528653
Sequence AGTTCTGTTGTTTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953173498_953173501 13 Left 953173498 3:40528595-40528617 CCCATTTCGCATTCATTAGCACC 0: 1
1: 0
2: 1
3: 6
4: 81
Right 953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG 0: 1
1: 0
2: 2
3: 14
4: 190
953173500_953173501 -8 Left 953173500 3:40528616-40528638 CCAGCAGTGAATGAGAGTTCTGT 0: 1
1: 5
2: 48
3: 250
4: 1252
Right 953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG 0: 1
1: 0
2: 2
3: 14
4: 190
953173497_953173501 26 Left 953173497 3:40528582-40528604 CCAAAGTGGCTGTCCCATTTCGC 0: 1
1: 9
2: 305
3: 918
4: 2001
Right 953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG 0: 1
1: 0
2: 2
3: 14
4: 190
953173499_953173501 12 Left 953173499 3:40528596-40528618 CCATTTCGCATTCATTAGCACCA 0: 1
1: 0
2: 1
3: 9
4: 92
Right 953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG 0: 1
1: 0
2: 2
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953173501 Original CRISPR AGTTCTGTTGTTTCACATCC TGG Intronic
901621415 1:10591205-10591227 TGTTCTGTTTTGACACATCCTGG - Intronic
903211406 1:21821428-21821450 AGTTCTGTTCTTTCCCATGCAGG + Exonic
905756852 1:40517711-40517733 AGTTTTCTTGTTGAACATCCTGG + Intergenic
907016284 1:51016718-51016740 AGTTTTGTTGTTTCTCATACAGG - Intergenic
909228330 1:73054656-73054678 AGTAATGTGGTTTCACATGCAGG - Intergenic
913291868 1:117281098-117281120 ATTTCTGTTGTTTAAGCTCCTGG - Intergenic
913597324 1:120391154-120391176 AAATCTGTTCTTTCACTTCCAGG - Intergenic
914090004 1:144488155-144488177 AAATCTGTTCTTTCACTTCCAGG + Intergenic
914308604 1:146446058-146446080 AAATCTGTTCTTTCACTTCCAGG - Intergenic
914344204 1:146784483-146784505 AGTAATTTTGTATCACATCCTGG + Intergenic
914514043 1:148358476-148358498 AAATCTGTTCTTTCACTTCCAGG + Intergenic
914593505 1:149127072-149127094 AAATCTGTTCTTTCACTTCCAGG + Intergenic
915066017 1:153224669-153224691 AGTTTTTATGTTGCACATCCTGG + Intergenic
915394264 1:155570359-155570381 GGTTATGTTGATTCATATCCAGG - Intergenic
917964423 1:180169413-180169435 AGTGATGTGGTTTCAAATCCAGG + Intronic
918131217 1:181631282-181631304 AGCTCTGATGTTTCAGGTCCAGG + Intronic
922351807 1:224740196-224740218 AATTATGTTGTCTCACTTCCTGG - Exonic
922430973 1:225552598-225552620 AGTTCTGTAGTTTTTCATCATGG - Intronic
923548327 1:234941134-234941156 ATTTCTCTTGTTTCACCTCCCGG - Intergenic
1065765207 10:29022999-29023021 TGTTCTGTTCTTTCAGAGCCAGG - Intergenic
1065970631 10:30803489-30803511 ATTTCTGTTGGTTAACATCCTGG + Intergenic
1065980936 10:30896387-30896409 AGTTGAGTTGTTTCACTTCTTGG - Intronic
1067779190 10:49186678-49186700 TGTTCTGTTGTTTACCAGCCTGG - Intronic
1067989875 10:51199818-51199840 AGCTCTGCTGTTACACATCCTGG + Intronic
1068926528 10:62545383-62545405 AGTGCTGGCGTTTCACTTCCAGG + Intronic
1069083411 10:64112603-64112625 ACCTCTGTTATTTCACATCTAGG - Intergenic
1069106368 10:64387595-64387617 AGGTCTGTTATTTCAAGTCCTGG - Intergenic
1069441536 10:68433102-68433124 AGTACTGTGCTTTCACAGCCTGG - Intronic
1074372038 10:112908061-112908083 AATTCTGTGGGTTCAAATCCTGG - Intergenic
1074450835 10:113558595-113558617 AATGCTGTTACTTCACATCCTGG + Intronic
1074774003 10:116753139-116753161 TGCCCTGTTGTTTCACAGCCTGG + Intergenic
1078550895 11:12280027-12280049 AGTTTTGTACTTTCCCATCCTGG + Intronic
1079207565 11:18429889-18429911 ATTCTTGTTGTTTCAAATCCAGG + Exonic
1080298920 11:30762397-30762419 GGTTCTGTTTTTTGACATACCGG + Intergenic
1080473368 11:32567775-32567797 AGTTCTGTTGCTCCACATCCTGG + Intergenic
1081081270 11:38742211-38742233 TTTTTTGTTGTTTCTCATCCAGG + Intergenic
1081718461 11:45268140-45268162 ATTCCTGTTGTGTCTCATCCTGG - Intronic
1083928905 11:65828061-65828083 AGTTCTGTAGTTCCAGTTCCTGG - Intronic
1089069447 11:115688250-115688272 ACCTCTGCTGTTTCCCATCCTGG + Intergenic
1091519842 12:1227055-1227077 ACTTATGTTGTTTCACATTTTGG + Intronic
1091751096 12:3021666-3021688 ACTCCTTTTGTTTTACATCCTGG - Intronic
1093924808 12:24899151-24899173 AGATACGTTGTTACACATCCTGG - Intronic
1097814809 12:64060737-64060759 AGATCCAATGTTTCACATCCTGG + Intronic
1103309833 12:119996416-119996438 AGTTCTATTACTTCACATCTGGG - Intronic
1109807843 13:67467490-67467512 AGTACTGTTGTTTGAAATCTGGG + Intergenic
1109973747 13:69803975-69803997 AGTTCTGTAGGTTCAAAGCCTGG - Intronic
1111384032 13:87500100-87500122 AGTTCTGTCTTTCCATATCCTGG + Intergenic
1111728765 13:92045734-92045756 AGTTCTCCTGTATCACTTCCTGG - Intronic
1112000249 13:95203296-95203318 AGTCCATTTGTTTCACAGCCTGG + Intronic
1113206930 13:107927450-107927472 AGTTTAGTTGCTTCACATTCTGG + Intergenic
1113557435 13:111249661-111249683 AGTTCTATTGTATCTCACCCTGG - Intronic
1117818532 14:59623370-59623392 GGACCTGTTGTTTCACTTCCTGG - Intronic
1121773513 14:96574188-96574210 AATTCCATTGTTTTACATCCTGG + Intergenic
1124195499 15:27623027-27623049 TGTCCTGTTCTTTCACTTCCTGG - Intergenic
1125035561 15:35120410-35120432 AGTTCCGTTGTTTCCAGTCCTGG - Intergenic
1126937303 15:53725315-53725337 ATTCCTGTTGCTCCACATCCCGG - Intronic
1127897875 15:63318324-63318346 AGATCTGTTGTTGGATATCCAGG + Intergenic
1129333935 15:74841447-74841469 TGTTCTGTGGCTTCAGATCCAGG + Exonic
1129559143 15:76547600-76547622 AGTTCTGCTTTTTCACATATAGG + Intronic
1132159265 15:99522540-99522562 AGTTCCCTTTTTTCACACCCTGG - Intergenic
1134860593 16:17556909-17556931 ATTTCTGATGCTTCACATTCCGG - Intergenic
1137966384 16:52937808-52937830 GTTCCTGTTGCTTCACATCCTGG - Intergenic
1139158401 16:64473014-64473036 AGTTTTATAGTTTCACATCTTGG - Intergenic
1139184037 16:64782837-64782859 GTTTCCGTTGTTTCACATGCTGG + Intergenic
1140908628 16:79431026-79431048 AGTTCCTTTGTGTGACATCCTGG + Intergenic
1143032363 17:3974762-3974784 ATGTCTGTTGTTACCCATCCTGG + Intergenic
1143820985 17:9562765-9562787 ACTTCTGTTTCTTCACAGCCTGG - Intronic
1144033771 17:11346015-11346037 AGTTGTCTTGTTTCTCATCCTGG + Intronic
1145192201 17:20852516-20852538 AGTCCTGTTGGTTCACGCCCCGG + Intronic
1145402426 17:22552561-22552583 AGTCCTGTTGGTTCACGCCCGGG + Intergenic
1146389345 17:32407121-32407143 ATTTCTGTTATTTCAACTCCTGG - Intergenic
1148331265 17:46815254-46815276 AGTGCTGTTGTTTCCTGTCCCGG + Intronic
1149151937 17:53576431-53576453 CATTTTGTTTTTTCACATCCAGG - Intergenic
1152786934 17:82253181-82253203 AGTTGTCTGGCTTCACATCCCGG + Exonic
1155846070 18:30708456-30708478 AGCTATGTTGTTTCACATATAGG - Intergenic
1156218936 18:35031685-35031707 TGTTCTGTGTTTTCACATCATGG + Intronic
1157093146 18:44660283-44660305 TGTTCTGTTCTTTCCCCTCCAGG + Intergenic
1157676302 18:49571239-49571261 AGGTGTGATGTTTCAGATCCAGG + Intronic
1158390594 18:57041762-57041784 ATTCTTGTTGTTTCACTTCCTGG + Intergenic
1160029422 18:75245690-75245712 AGATTTTGTGTTTCACATCCGGG + Intronic
1160070414 18:75623221-75623243 ACTTCTGTTGTTTAAGGTCCTGG + Intergenic
1164214631 19:23134269-23134291 AATTCTGTGCTTTCAGATCCCGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166889361 19:45981062-45981084 AGCACTGCTGTCTCACATCCTGG - Intergenic
925452988 2:3986831-3986853 AGGTCTGTTTTTTCACTCCCAGG + Intergenic
929157974 2:38804815-38804837 TGCTCAGTTGTTTCTCATCCCGG + Intronic
930905713 2:56564443-56564465 AGTTTTGTTTTTTCCCATGCAGG + Intergenic
932727613 2:74193083-74193105 AGTTCTGTTGAATTTCATCCTGG - Intergenic
935454180 2:103247169-103247191 ATTTCTGCTGTTTCACATTCTGG + Intergenic
937069310 2:119050561-119050583 AGTTCTTTTCTTTCACAGCTGGG - Intergenic
940027883 2:149227765-149227787 AGCTGTGTTGTTTCCCTTCCTGG + Intergenic
940595047 2:155780486-155780508 AGTTCTGTGGTTGGACTTCCTGG + Intergenic
943208931 2:184937857-184937879 AGTTCTAAAGTTTCAAATCCGGG - Exonic
944082151 2:195800000-195800022 AGTTCTGCTGTTTCTCAAACAGG - Intronic
945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG + Intergenic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
947328984 2:229008636-229008658 AGCCCTGTTCTTTCACATCTGGG + Intronic
947786958 2:232831741-232831763 AGTTCAGATGTTTCACGTCATGG + Intronic
1169986369 20:11449833-11449855 AGTTCTGTTGTTACTCATTTAGG - Intergenic
1172394436 20:34590186-34590208 ATTTCTGTTTTCTCACATACTGG - Intronic
1174719090 20:52791785-52791807 AGTTCATCTGTTTCACATACTGG + Intergenic
1176363633 21:6019180-6019202 AGTTCTGTTGATTTTCACCCTGG - Intergenic
1176931414 21:14815283-14815305 TGGTCTGTTGATTCACATCCTGG + Intergenic
1178080708 21:29061530-29061552 ATTTCTGTTGCTCCACCTCCGGG + Exonic
1178548831 21:33517590-33517612 ATTTCTGCTGTTTCACCTCCTGG + Exonic
1179759885 21:43519365-43519387 AGTTCTGTTGATTTTCACCCTGG + Intergenic
1179782147 21:43708327-43708349 AGTTCACTTGGTTCACATCAGGG + Intergenic
1181405563 22:22682069-22682091 AGTTCTGCTGGGACACATCCTGG + Intergenic
1181412708 22:22735265-22735287 CGCTCTGTGGTTTCTCATCCAGG + Intronic
1181416044 22:22759387-22759409 CGCTCTGTGGTTTCTCATCCAGG + Intronic
1181428166 22:22857236-22857258 TGCTCTGTGGTTTCTCATCCAGG + Intronic
1182025183 22:27112426-27112448 GGTACTGTTGTCTCCCATCCTGG + Intergenic
1185305048 22:50110575-50110597 TGTTTTGTTGTTTCACATTTTGG + Intronic
952289454 3:32001236-32001258 AGTTCTCTTGGGACACATCCAGG - Intronic
952684405 3:36132162-36132184 ATTTCTGTTCTTTCCAATCCAGG + Intergenic
953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG + Intronic
953870365 3:46620939-46620961 AGTTATTTTGTTTAACATGCAGG + Intronic
956451540 3:69379855-69379877 AGTTTTGTTGGCTCACAGCCAGG - Intronic
957047312 3:75385959-75385981 AGTTCTGCTTTTTCTCACCCAGG - Intergenic
957989963 3:87614977-87614999 AGTTGGGATGTTTCCCATCCTGG + Intergenic
958728866 3:97938582-97938604 AGTTCTGTTGGTTCAAATCCTGG + Intronic
959627013 3:108464020-108464042 AGTTCTCTTCTTTGATATCCTGG - Intronic
960368342 3:116802944-116802966 AGATCTCTTGTTTTACATCTTGG - Intronic
960628546 3:119704417-119704439 AGTTCTGATTTTCCCCATCCAGG - Intronic
964159653 3:153631703-153631725 ATTTCTGTTCTATCAAATCCTGG - Intergenic
964584219 3:158278049-158278071 AGTTGTGATGTTTCACATTAGGG - Intronic
964597179 3:158446766-158446788 CGTTCTGTTCTTTCACATGAAGG - Intronic
965543176 3:169890547-169890569 AGGTCTGTTGTCTCACATTCTGG + Intergenic
965890509 3:173508237-173508259 AATTCTTTTGTTTTACAGCCAGG + Intronic
966591924 3:181693836-181693858 AGATCTGTGGTTTCACAGCTGGG - Intergenic
968036033 3:195548767-195548789 AGTTCTGTTGAATCTCACCCTGG - Intergenic
968840079 4:2997008-2997030 AGTTCTCTTTTTTCAACTCCTGG - Intronic
969840048 4:9874680-9874702 AGTCCTGTTGTGTCAGAACCTGG + Intronic
971380771 4:26095548-26095570 AGTTCAGGAGTTTGACATCCTGG + Intergenic
971391013 4:26185164-26185186 AGTTATGTTGTTTTGCATCAAGG + Intronic
971658146 4:29376707-29376729 AGTTCTGCTGTTTGGCTTCCAGG + Intergenic
973138585 4:46737082-46737104 GTTTCTTTTGTTCCACATCCTGG + Intronic
974012060 4:56615980-56616002 AGTTCTGGGGTTTCATCTCCTGG + Intergenic
978084696 4:104636306-104636328 AGTGCTGAAGTTTCAAATCCAGG - Intergenic
980996412 4:139783847-139783869 AGTTATGTTGTGTGACAGCCCGG + Intronic
982052832 4:151519786-151519808 AATTCTGTTGCTCCATATCCTGG + Intronic
982600417 4:157442813-157442835 TGTACTGTTCTTTCTCATCCAGG + Intergenic
985889040 5:2701534-2701556 ATTTCTCTTGTTTGACATCTTGG + Intergenic
986441968 5:7791005-7791027 AGTTCTGTTGACTCTTATCCTGG - Intronic
986777298 5:11028236-11028258 AGTTGTGATGTTTCTCATCCGGG - Intronic
992541980 5:77775069-77775091 AGTTCTGTTGTATTTCACCCTGG + Intronic
992998955 5:82360811-82360833 AGAGCTGTGGTTTCTCATCCAGG + Intronic
993237806 5:85336942-85336964 TGTTCTTTTCTTTCACATCAAGG + Intergenic
993449974 5:88061452-88061474 AGCTTTGGAGTTTCACATCCTGG + Intergenic
993706184 5:91173430-91173452 AGTTTCTTTGTTTCATATCCAGG - Intergenic
994742315 5:103635642-103635664 AGTTCTGATGATTTACATCAGGG + Intergenic
994883760 5:105530900-105530922 AATGCTGTTGGTTCACATCTGGG - Intergenic
996410700 5:123155892-123155914 AGTGCTGTAGTGTCCCATCCTGG - Exonic
1000505219 5:162108369-162108391 AGTTCGGTTCTTTCACAAGCTGG - Intronic
1002977041 6:2090215-2090237 TATTGTTTTGTTTCACATCCAGG - Intronic
1007340360 6:41187496-41187518 AGTTCTGTTGATTTTCACCCTGG - Intergenic
1008590749 6:52991430-52991452 ACTTCTATTGTATCACATCAGGG - Intronic
1009769605 6:68128330-68128352 TGTTTTGTTGTTTTACCTCCTGG - Intergenic
1010105717 6:72164768-72164790 AGATTTGTTGTCTCAAATCCTGG + Intronic
1012960624 6:105617877-105617899 GGCTCTGTGGTTTCACATCATGG + Intergenic
1013743012 6:113310877-113310899 AATTGTTTTGTTTCACATGCAGG + Intergenic
1015039615 6:128701400-128701422 ATTTCTGTAGTTTCAAGTCCAGG + Intergenic
1018553278 6:165023457-165023479 ATTCTTGTTGTTCCACATCCTGG - Intergenic
1024436866 7:49366790-49366812 AAATGTGTTGTCTCACATCCTGG + Intergenic
1026597827 7:71749213-71749235 AGTTCTGATGTTGCAGCTCCTGG - Intergenic
1029254249 7:99258475-99258497 AGTTCTCTTGTTTCTCACCTTGG + Intergenic
1036696352 8:10977516-10977538 AGTTCTGTTGTTACATATTTTGG - Intronic
1037021117 8:13972018-13972040 AGAACTGCTGTTTTACATCCTGG - Intergenic
1037464784 8:19149555-19149577 AGTACTGTTCTTTCACACCAGGG - Intergenic
1038725322 8:30077152-30077174 AGTTCTGTTGTTTTTAATCTTGG - Intronic
1041730832 8:61061119-61061141 AGTTCTGTTTTATAAAATCCAGG - Intronic
1045837420 8:106538471-106538493 AGTTTTGTTGTTCCAAATCTAGG + Intronic
1046792899 8:118340859-118340881 ACTTCAATTGTTTTACATCCTGG - Intronic
1049035595 8:140073550-140073572 AGTTCTCTTGTATCCCATCTAGG - Intronic
1050976605 9:11946764-11946786 AGTTCTGGTGTTTCTCACACTGG - Intergenic
1051410845 9:16788114-16788136 AGTTCAGTTGTCACAAATCCAGG - Intronic
1051675620 9:19555470-19555492 AGTACTGTCATTTCTCATCCTGG + Intronic
1055347033 9:75350273-75350295 AGTTCTTTTCTTTCGCAGCCGGG - Intergenic
1055696684 9:78892442-78892464 ATTTCCTTTGTTTCACTTCCAGG + Intergenic
1057690271 9:97277636-97277658 AGTTCTGTTCATTCACCTGCAGG + Intergenic
1058255376 9:102755870-102755892 AGTTCTGTTGTTTGATAGCGTGG - Intergenic
1059076193 9:111196495-111196517 AATGATGTTGTTTCACTTCCAGG - Intergenic
1059370368 9:113826099-113826121 AGTTCTATTGTTGCACCTTCTGG - Intergenic
1059747094 9:117213763-117213785 AATTCTAATTTTTCACATCCTGG - Intronic
1060046355 9:120344417-120344439 AGTTATGTGGTTGTACATCCAGG + Intergenic
1060090170 9:120735627-120735649 AGTTCTGTTTCTTCATGTCCTGG + Intergenic
1061699151 9:132402193-132402215 AGTTCTGTAATTTCACCCCCTGG + Exonic
1203491057 Un_GL000224v1:105196-105218 AGTTCTGTTGATTCACATTTTGG + Intergenic
1203503681 Un_KI270741v1:47067-47089 AGTTCTGTTGATTCACATTTTGG + Intergenic
1186050782 X:5592656-5592678 AGTTCTGTTGAATTTCATCCTGG + Intergenic
1186068157 X:5788819-5788841 AGTTCTGTTTTTCTACACCCAGG + Intergenic
1187253996 X:17624654-17624676 AATTCTGGTGTTTCACACCATGG - Intronic
1187279211 X:17844701-17844723 AGATTTGTTGTATCACATGCAGG - Intronic
1187349555 X:18500060-18500082 ATTTCTGTTTTTTCTTATCCTGG + Intronic
1188197084 X:27249479-27249501 AGTTCTGTCGTTTCAAAGCAAGG - Intergenic
1188909092 X:35823504-35823526 AGTTCTGTTGGATTTCATCCTGG + Intergenic
1189735313 X:44064131-44064153 AGTTCTTTTGATTCCCATCTGGG - Intergenic
1193214452 X:78846690-78846712 ATTTGGGTTGTTTCACATCTTGG - Intergenic
1194087153 X:89542490-89542512 ATTTCACTTTTTTCACATCCTGG + Intergenic
1197565347 X:128077402-128077424 AGTTCTGTTGGTTTATACCCTGG - Intergenic
1198107415 X:133474750-133474772 AGTTCTGTTAGTTAACATCTGGG + Intergenic
1198316579 X:135473336-135473358 ACCTATGTTGTTTCAGATCCAGG - Intergenic
1199617866 X:149671947-149671969 AGTTCTGGTGGGTCACATCGTGG + Intergenic
1199624776 X:149731302-149731324 AGTTCTGGTGGGTCACATCGTGG - Intergenic
1200270833 X:154681224-154681246 ATTTCTATTGCTTCCCATCCTGG + Intronic
1200439801 Y:3198363-3198385 ATTTCACTTTTTTCACATCCTGG + Intergenic
1201638062 Y:16147344-16147366 AGTTCTGTTGATTTTCACCCTGG + Intergenic