ID: 953180438

View in Genome Browser
Species Human (GRCh38)
Location 3:40589756-40589778
Sequence CAGCATGCTCAGAGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953180438_953180443 1 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180443 3:40589780-40589802 TAGCCCACTGTGGTTACTGCAGG No data
953180438_953180442 -9 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180442 3:40589770-40589792 AGCATGCTGGTAGCCCACTGTGG No data
953180438_953180445 4 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180445 3:40589783-40589805 CCCACTGTGGTTACTGCAGGTGG No data
953180438_953180448 30 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953180438 Original CRISPR CAGCATGCTCAGAGGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr