ID: 953180442

View in Genome Browser
Species Human (GRCh38)
Location 3:40589770-40589792
Sequence AGCATGCTGGTAGCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953180438_953180442 -9 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180442 3:40589770-40589792 AGCATGCTGGTAGCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953180442 Original CRISPR AGCATGCTGGTAGCCCACTG TGG Intergenic
No off target data available for this crispr