ID: 953180443

View in Genome Browser
Species Human (GRCh38)
Location 3:40589780-40589802
Sequence TAGCCCACTGTGGTTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953180438_953180443 1 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180443 3:40589780-40589802 TAGCCCACTGTGGTTACTGCAGG No data
953180441_953180443 -7 Left 953180441 3:40589764-40589786 CCTCTGAGCATGCTGGTAGCCCA No data
Right 953180443 3:40589780-40589802 TAGCCCACTGTGGTTACTGCAGG No data
953180440_953180443 -6 Left 953180440 3:40589763-40589785 CCCTCTGAGCATGCTGGTAGCCC No data
Right 953180443 3:40589780-40589802 TAGCCCACTGTGGTTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953180443 Original CRISPR TAGCCCACTGTGGTTACTGC AGG Intergenic
No off target data available for this crispr