ID: 953180448

View in Genome Browser
Species Human (GRCh38)
Location 3:40589809-40589831
Sequence CCCTAGCTTAGAGCAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953180438_953180448 30 Left 953180438 3:40589756-40589778 CCAAGAGCCCTCTGAGCATGCTG No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data
953180441_953180448 22 Left 953180441 3:40589764-40589786 CCTCTGAGCATGCTGGTAGCCCA No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data
953180444_953180448 3 Left 953180444 3:40589783-40589805 CCCACTGTGGTTACTGCAGGTGG No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data
953180446_953180448 2 Left 953180446 3:40589784-40589806 CCACTGTGGTTACTGCAGGTGGT No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data
953180440_953180448 23 Left 953180440 3:40589763-40589785 CCCTCTGAGCATGCTGGTAGCCC No data
Right 953180448 3:40589809-40589831 CCCTAGCTTAGAGCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953180448 Original CRISPR CCCTAGCTTAGAGCAGTGAC TGG Intergenic
No off target data available for this crispr