ID: 953185302

View in Genome Browser
Species Human (GRCh38)
Location 3:40631805-40631827
Sequence GCTGCAGCAAACCCCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953185297_953185302 -6 Left 953185297 3:40631788-40631810 CCCCATCTCCCACAGCAGCTGCA No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185296_953185302 -5 Left 953185296 3:40631787-40631809 CCCCCATCTCCCACAGCAGCTGC No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185298_953185302 -7 Left 953185298 3:40631789-40631811 CCCATCTCCCACAGCAGCTGCAG No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185299_953185302 -8 Left 953185299 3:40631790-40631812 CCATCTCCCACAGCAGCTGCAGC No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185295_953185302 0 Left 953185295 3:40631782-40631804 CCACACCCCCATCTCCCACAGCA No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185294_953185302 8 Left 953185294 3:40631774-40631796 CCTGTGAACCACACCCCCATCTC No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data
953185293_953185302 15 Left 953185293 3:40631767-40631789 CCATTGGCCTGTGAACCACACCC No data
Right 953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953185302 Original CRISPR GCTGCAGCAAACCCCACCCA AGG Intergenic