ID: 953192879

View in Genome Browser
Species Human (GRCh38)
Location 3:40705031-40705053
Sequence CTCAAGCTTGCAGCCTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953192870_953192879 22 Left 953192870 3:40704986-40705008 CCCCAAGTTATTCAGTTTTGAGA No data
Right 953192879 3:40705031-40705053 CTCAAGCTTGCAGCCTATTGTGG No data
953192872_953192879 20 Left 953192872 3:40704988-40705010 CCAAGTTATTCAGTTTTGAGACT No data
Right 953192879 3:40705031-40705053 CTCAAGCTTGCAGCCTATTGTGG No data
953192871_953192879 21 Left 953192871 3:40704987-40705009 CCCAAGTTATTCAGTTTTGAGAC No data
Right 953192879 3:40705031-40705053 CTCAAGCTTGCAGCCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953192879 Original CRISPR CTCAAGCTTGCAGCCTATTG TGG Intergenic
No off target data available for this crispr