ID: 953193044

View in Genome Browser
Species Human (GRCh38)
Location 3:40707230-40707252
Sequence TTCGTTTAACATTTCTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953193042_953193044 -6 Left 953193042 3:40707213-40707235 CCTTCTTTCCGAAGGACTTCGTT No data
Right 953193044 3:40707230-40707252 TTCGTTTAACATTTCTTGAAAGG No data
953193040_953193044 7 Left 953193040 3:40707200-40707222 CCTATATCATTTTCCTTCTTTCC No data
Right 953193044 3:40707230-40707252 TTCGTTTAACATTTCTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953193044 Original CRISPR TTCGTTTAACATTTCTTGAA AGG Intergenic
No off target data available for this crispr