ID: 953194546

View in Genome Browser
Species Human (GRCh38)
Location 3:40720232-40720254
Sequence GAATTTGTCTGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953194546_953194552 0 Left 953194546 3:40720232-40720254 CCTTATGCCCCTCAGACAAATTC No data
Right 953194552 3:40720255-40720277 TCTGGAGGCAAGAATTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953194546 Original CRISPR GAATTTGTCTGAGGGGCATA AGG (reversed) Intergenic
No off target data available for this crispr