ID: 953198225

View in Genome Browser
Species Human (GRCh38)
Location 3:40753939-40753961
Sequence GGGCCTCGGTGCTCACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953198225_953198232 3 Left 953198225 3:40753939-40753961 CCCAAGTGTGAGCACCGAGGCCC No data
Right 953198232 3:40753965-40753987 GGAGAAGCTCCCATTGTGGTAGG No data
953198225_953198231 -1 Left 953198225 3:40753939-40753961 CCCAAGTGTGAGCACCGAGGCCC No data
Right 953198231 3:40753961-40753983 CTTTGGAGAAGCTCCCATTGTGG No data
953198225_953198234 5 Left 953198225 3:40753939-40753961 CCCAAGTGTGAGCACCGAGGCCC No data
Right 953198234 3:40753967-40753989 AGAAGCTCCCATTGTGGTAGGGG No data
953198225_953198233 4 Left 953198225 3:40753939-40753961 CCCAAGTGTGAGCACCGAGGCCC No data
Right 953198233 3:40753966-40753988 GAGAAGCTCCCATTGTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953198225 Original CRISPR GGGCCTCGGTGCTCACACTT GGG (reversed) Intergenic
No off target data available for this crispr