ID: 953199617

View in Genome Browser
Species Human (GRCh38)
Location 3:40767292-40767314
Sequence TTCAAACAGAAATGCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953199617_953199621 -2 Left 953199617 3:40767292-40767314 CCTGGGATGCATTTCTGTTTGAA No data
Right 953199621 3:40767313-40767335 AAATGTTAGGGAATTAACAAGGG No data
953199617_953199620 -3 Left 953199617 3:40767292-40767314 CCTGGGATGCATTTCTGTTTGAA No data
Right 953199620 3:40767312-40767334 GAAATGTTAGGGAATTAACAAGG No data
953199617_953199624 13 Left 953199617 3:40767292-40767314 CCTGGGATGCATTTCTGTTTGAA No data
Right 953199624 3:40767328-40767350 AACAAGGGTGACCTGGCACAGGG No data
953199617_953199623 12 Left 953199617 3:40767292-40767314 CCTGGGATGCATTTCTGTTTGAA No data
Right 953199623 3:40767327-40767349 TAACAAGGGTGACCTGGCACAGG No data
953199617_953199622 6 Left 953199617 3:40767292-40767314 CCTGGGATGCATTTCTGTTTGAA No data
Right 953199622 3:40767321-40767343 GGGAATTAACAAGGGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953199617 Original CRISPR TTCAAACAGAAATGCATCCC AGG (reversed) Intergenic
No off target data available for this crispr