ID: 953200848

View in Genome Browser
Species Human (GRCh38)
Location 3:40777323-40777345
Sequence TTATTAGAAGCAGTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953200848_953200857 23 Left 953200848 3:40777323-40777345 CCACATCACACTGCTTCTAATAA No data
Right 953200857 3:40777369-40777391 TGCAGATGGAGTAGTAGTCAGGG No data
953200848_953200856 22 Left 953200848 3:40777323-40777345 CCACATCACACTGCTTCTAATAA No data
Right 953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG No data
953200848_953200851 9 Left 953200848 3:40777323-40777345 CCACATCACACTGCTTCTAATAA No data
Right 953200851 3:40777355-40777377 AGCATGACCCACCCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953200848 Original CRISPR TTATTAGAAGCAGTGTGATG TGG (reversed) Intergenic
No off target data available for this crispr