ID: 953200850

View in Genome Browser
Species Human (GRCh38)
Location 3:40777352-40777374
Sequence TCTGCAGGGTGGGTCATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953200850_953200858 11 Left 953200850 3:40777352-40777374 CCAAGCATGACCCACCCTGCAGA No data
Right 953200858 3:40777386-40777408 TCAGGGTTCTCTAGAGAACTAGG No data
953200850_953200857 -6 Left 953200850 3:40777352-40777374 CCAAGCATGACCCACCCTGCAGA No data
Right 953200857 3:40777369-40777391 TGCAGATGGAGTAGTAGTCAGGG No data
953200850_953200856 -7 Left 953200850 3:40777352-40777374 CCAAGCATGACCCACCCTGCAGA No data
Right 953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953200850 Original CRISPR TCTGCAGGGTGGGTCATGCT TGG (reversed) Intergenic
No off target data available for this crispr