ID: 953200856

View in Genome Browser
Species Human (GRCh38)
Location 3:40777368-40777390
Sequence CTGCAGATGGAGTAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953200850_953200856 -7 Left 953200850 3:40777352-40777374 CCAAGCATGACCCACCCTGCAGA No data
Right 953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG No data
953200848_953200856 22 Left 953200848 3:40777323-40777345 CCACATCACACTGCTTCTAATAA No data
Right 953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953200856 Original CRISPR CTGCAGATGGAGTAGTAGTC AGG Intergenic
No off target data available for this crispr