ID: 953200967

View in Genome Browser
Species Human (GRCh38)
Location 3:40778250-40778272
Sequence CAAACCATACTCTGAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953200965_953200967 0 Left 953200965 3:40778227-40778249 CCAGTGATGAAGAAATGATTCCT No data
Right 953200967 3:40778250-40778272 CAAACCATACTCTGAGAGCATGG No data
953200964_953200967 19 Left 953200964 3:40778208-40778230 CCAACAAAGGCAGAAACTTCCAG No data
Right 953200967 3:40778250-40778272 CAAACCATACTCTGAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953200967 Original CRISPR CAAACCATACTCTGAGAGCA TGG Intergenic
No off target data available for this crispr