ID: 953202764

View in Genome Browser
Species Human (GRCh38)
Location 3:40792211-40792233
Sequence CTCCAGGTTCATGTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953202764_953202772 26 Left 953202764 3:40792211-40792233 CCTGCCTCCACATGAACCTGGAG No data
Right 953202772 3:40792260-40792282 CTCTGTCTTTGGCATAATTGTGG No data
953202764_953202769 3 Left 953202764 3:40792211-40792233 CCTGCCTCCACATGAACCTGGAG No data
Right 953202769 3:40792237-40792259 GGTTTCTAGTAGTTGCCAGCAGG No data
953202764_953202770 15 Left 953202764 3:40792211-40792233 CCTGCCTCCACATGAACCTGGAG No data
Right 953202770 3:40792249-40792271 TTGCCAGCAGGCTCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953202764 Original CRISPR CTCCAGGTTCATGTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr