ID: 953203316

View in Genome Browser
Species Human (GRCh38)
Location 3:40797555-40797577
Sequence AATATCTATGAGAGAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953203316_953203319 17 Left 953203316 3:40797555-40797577 CCACATTTTCTCTCATAGATATT No data
Right 953203319 3:40797595-40797617 TTGCATGTTTAACCTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953203316 Original CRISPR AATATCTATGAGAGAAAATG TGG (reversed) Intergenic
No off target data available for this crispr