ID: 953204815

View in Genome Browser
Species Human (GRCh38)
Location 3:40816142-40816164
Sequence CCTCATTGGCACCCATAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953204811_953204815 -10 Left 953204811 3:40816129-40816151 CCGTAACAATGGCCCTCATTGGC No data
Right 953204815 3:40816142-40816164 CCTCATTGGCACCCATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953204815 Original CRISPR CCTCATTGGCACCCATAGGC AGG Intergenic
No off target data available for this crispr