ID: 953205724

View in Genome Browser
Species Human (GRCh38)
Location 3:40827106-40827128
Sequence GTTTATGGTCAGAGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953205724_953205729 23 Left 953205724 3:40827106-40827128 CCCAGAGCTCTCTGACCATAAAC No data
Right 953205729 3:40827152-40827174 AGTCACAAAGTGAAGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953205724 Original CRISPR GTTTATGGTCAGAGAGCTCT GGG (reversed) Intergenic
No off target data available for this crispr