ID: 953206572

View in Genome Browser
Species Human (GRCh38)
Location 3:40835731-40835753
Sequence CAGCATTTCATTGTAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953206572_953206574 21 Left 953206572 3:40835731-40835753 CCCACTTTTACAATGAAATGCTG No data
Right 953206574 3:40835775-40835797 AAGAAATATGTCCAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953206572 Original CRISPR CAGCATTTCATTGTAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr