ID: 953206573

View in Genome Browser
Species Human (GRCh38)
Location 3:40835732-40835754
Sequence GCAGCATTTCATTGTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953206573_953206574 20 Left 953206573 3:40835732-40835754 CCACTTTTACAATGAAATGCTGC No data
Right 953206574 3:40835775-40835797 AAGAAATATGTCCAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953206573 Original CRISPR GCAGCATTTCATTGTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr