ID: 953206574

View in Genome Browser
Species Human (GRCh38)
Location 3:40835775-40835797
Sequence AAGAAATATGTCCAAAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953206572_953206574 21 Left 953206572 3:40835731-40835753 CCCACTTTTACAATGAAATGCTG No data
Right 953206574 3:40835775-40835797 AAGAAATATGTCCAAAGACATGG No data
953206573_953206574 20 Left 953206573 3:40835732-40835754 CCACTTTTACAATGAAATGCTGC No data
Right 953206574 3:40835775-40835797 AAGAAATATGTCCAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953206574 Original CRISPR AAGAAATATGTCCAAAGACA TGG Intergenic
No off target data available for this crispr