ID: 953210459

View in Genome Browser
Species Human (GRCh38)
Location 3:40870631-40870653
Sequence GGTTTCCAGCAGCGGCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953210459_953210463 -9 Left 953210459 3:40870631-40870653 CCCACAAGCCGCTGCTGGAAACC No data
Right 953210463 3:40870645-40870667 CTGGAAACCCTCCCTGGCTTTGG No data
953210459_953210467 2 Left 953210459 3:40870631-40870653 CCCACAAGCCGCTGCTGGAAACC No data
Right 953210467 3:40870656-40870678 CCCTGGCTTTGGACAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953210459 Original CRISPR GGTTTCCAGCAGCGGCTTGT GGG (reversed) Intergenic
No off target data available for this crispr