ID: 953215016

View in Genome Browser
Species Human (GRCh38)
Location 3:40909852-40909874
Sequence TGCCACTGCCATAGTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953215012_953215016 20 Left 953215012 3:40909809-40909831 CCTTGTTTTGAGGTTTGAAACTT No data
Right 953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953215016 Original CRISPR TGCCACTGCCATAGTGGGCC AGG Intergenic
No off target data available for this crispr