ID: 953216865

View in Genome Browser
Species Human (GRCh38)
Location 3:40926936-40926958
Sequence GTTAACTCCCTTGCATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953216862_953216865 21 Left 953216862 3:40926892-40926914 CCAGCTCAGGACTCTCCACTGGT No data
Right 953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG No data
953216860_953216865 24 Left 953216860 3:40926889-40926911 CCACCAGCTCAGGACTCTCCACT No data
Right 953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG No data
953216863_953216865 6 Left 953216863 3:40926907-40926929 CCACTGGTCAAAAGTTTGCCTTC No data
Right 953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953216865 Original CRISPR GTTAACTCCCTTGCATTTCC AGG Intergenic
No off target data available for this crispr