ID: 953220030

View in Genome Browser
Species Human (GRCh38)
Location 3:40961074-40961096
Sequence ATGGACAAATGTGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953220030_953220037 23 Left 953220030 3:40961074-40961096 CCTACAAAGGCACATTTGTCCAT No data
Right 953220037 3:40961120-40961142 CTTTAGGGATATGAGAGCTGGGG No data
953220030_953220034 8 Left 953220030 3:40961074-40961096 CCTACAAAGGCACATTTGTCCAT No data
Right 953220034 3:40961105-40961127 ATCAAATTATTGTTTCTTTAGGG No data
953220030_953220036 22 Left 953220030 3:40961074-40961096 CCTACAAAGGCACATTTGTCCAT No data
Right 953220036 3:40961119-40961141 TCTTTAGGGATATGAGAGCTGGG No data
953220030_953220035 21 Left 953220030 3:40961074-40961096 CCTACAAAGGCACATTTGTCCAT No data
Right 953220035 3:40961118-40961140 TTCTTTAGGGATATGAGAGCTGG No data
953220030_953220033 7 Left 953220030 3:40961074-40961096 CCTACAAAGGCACATTTGTCCAT No data
Right 953220033 3:40961104-40961126 CATCAAATTATTGTTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953220030 Original CRISPR ATGGACAAATGTGCCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr