ID: 953223599

View in Genome Browser
Species Human (GRCh38)
Location 3:40997285-40997307
Sequence CAAAAGCGTCCCTGATGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953223599_953223605 12 Left 953223599 3:40997285-40997307 CCCCAGCATCAGGGACGCTTTTG No data
Right 953223605 3:40997320-40997342 GGGCCTCCAGCTGTGCTGTGAGG No data
953223599_953223602 -10 Left 953223599 3:40997285-40997307 CCCCAGCATCAGGGACGCTTTTG No data
Right 953223602 3:40997298-40997320 GACGCTTTTGATAACAACAGAGG No data
953223599_953223604 -8 Left 953223599 3:40997285-40997307 CCCCAGCATCAGGGACGCTTTTG No data
Right 953223604 3:40997300-40997322 CGCTTTTGATAACAACAGAGGGG No data
953223599_953223603 -9 Left 953223599 3:40997285-40997307 CCCCAGCATCAGGGACGCTTTTG No data
Right 953223603 3:40997299-40997321 ACGCTTTTGATAACAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953223599 Original CRISPR CAAAAGCGTCCCTGATGCTG GGG (reversed) Intergenic
No off target data available for this crispr